Transcript

si:ch211-133l11.10-201

ID
ZDB-TSCRIPT-141209-2800
Name
si:ch211-133l11.10-201
Previous Names
  • ch211-133l11.10-002
  • si:ch211-133l11.10-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052584 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052584|OTTDARG00000036913|ZDB-GENE-141219-14 si:ch211-133l11.10|OTTDARP00000041336 CH211-133L11.10-002 LG_ AL929114.8 Danio rerio protein_coding NOVEL, 1491 bp
GTGAAACGCATCACTGAGCTTGCTCGCGCGCGCGCGTGTG
TGTGTGTGTGTGTAATAATCCTCTTTACTGCAGCAGATGC
TCGTCTGTCAATCAACCGGACCGAACTTGACTTGAGAGCG
CGAGAGAAACAACCCAGCAGGCGTCATTTAGCGATGCAGG
AATGGTAAATAAAGCTGTATTCTACACACACCATACCATG
ATAGCGACCACAGTCGTGTTTAAAAGTTGCATTTGTTGAC
CGGATAACGCAATGCCGTCGCAGGATGATGCCGAGTCGGT
AAATGAAGACGATTTTCCGCCTCCGGTTCCACCGCGAGTA
GCTCCACCGCGAGACACGCCGGCAGCATCTGAACGCCGGG
TAAAGTGTGTGATGGTCGGCGATGGAGCGGTGGGTAAAAC
CAGTCTGATTATCAGCTACACCACCAACGGATATCCGGCA
GAACACATTCCCACTGCCTTTGACAACTTCACAGCCAGGG
TAGTGGTGGACGGGAGACCAGTTCAACTTCAGCTGTGTGA
CATGGCAGGACAGGATGACTTTGACCGACTCCGCCCACTC
TGTTACCGTGATGCTGATGTGTTCCTGCTCTGCTACAGCG
TGGTCCTCCCATCCTCCTTCAGAAGTGTGACTGACCGATG
GGCTCCTGAAATTAATCGAATCTGTCCTGGTGTTCCCATC
ATCCTCGTGGGCACTCAGTGTGATTTACTTGAAGACGTTC
AGGTGCTTATCCGACTCGCAGAGGGCCAGGAGAAACCAGT
GAGCCAGGAAGACGCCCGATTGTGTGCCCGTAGCATCGGT
GCCGTGACATTCGCTGAATGTTCAGCTCTGACACAGAAGA
ACCTGAAGGAAGTGTTCGACGCCGCCATCTTAGCTAGCAT
GAAGCATGCAGAGGAGTCGATGTGGCCGAGGATCCAGACG
CTGAGAGAAAAAACCCCAGATAAAATCAGACAGCTTTCTG
AAAGCTGGTGGAAGAAACTGAGCTGCGTCCAGAGCTTTGA
TTTTCAGTGACAGAGGATCCGCTGAAATCTCGGTGTGATT
TGGCTCAGCATTGCTAGCGCTGGATTAGCTGATCCTGTGA
ACAGACTGAAGATCAGGACTAAAGGAGAGGGATTTGAGCT
CTGCGTTACACCTGTTGTGCTCCCCTATAATCTGATGTTC
ATTAGCAACGTCATTTCTGCCGTTTACATCATTTTGTACT
GTGAAAATTGTGCTTGTTGCTGCTTGTTCAAATGACTTAT
TTAAAATGAACTATCAATGCAATTCTAGAGTTTTTTGGGG
GGGACGACTTAATGATTTTATGTTCCATCCACTTAAATTT
GTAAAAATAATTAAGTCAGCTTAATCGGTTTGTGTTTGGA
CAAAATTGTGTGGAACACAGTATTTGTTTATTTATTTTTT
TTGCAAAATAAGTGTAAAATGAGAACTGTCCCACCAGGCA
CAGGACGTCAACATGGCGTCAGATTGACATTGTACCCCAA
CTTCAGGGCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations