Transcript

lims1-201

ID
ZDB-TSCRIPT-141209-3382
Name
lims1-201
Previous Names
  • lims1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061377 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061377|OTTDARG00000042528|ZDB-GENE-050522-236 lims1|OTTDARP00000047600 lims1-001 LG_ CU694209.13 Danio rerio protein_coding NOVEL, 3817 bp
CTCGGAAGCTCAAGCAGAGTGGACTGCGTTCTTTAGGAAA
ACATCTTTGTCTCCGAGAGAGAAGGGGAAAAAGTGGAAAA
GCAACAGATCGGAGGGGCGTCTTATGTTGTCGAAAAACAT
CTGAGTCGTCTTTCAGGATTAGCCGTGCTGAAGGGGATGC
TGGGGGTGTCAGAGATGACGGGCAGTAACATGGCCAATGC
CCTGGCAAACGCCTCATGTGAGCGGTGTAAAAGTGGATTT
GCCCCAGCAGAGAAGATAGTCAACAGTAATGGTGAGCTCT
ATCATGAGCAGTGCTTCGTCTGCGCCCAATGTTTCCAGCA
GTTTCCTGAAGGGCTCTTTTATGAGTTTGAGGGAAGGAAG
TACTGTGAGCATGATTTCCAGATGTTGTTTGCTCCCTGTT
GTCACCAGTGTGGAGAGTTTATAATTGGGCGTGTGATTAA
GGCCATGAATAACAGCTGGCACCCGGACTGTTTCTGCTGT
GATATCTGCCAAGCGGTGCTCGCCGATGTTGGATTCGTCA
AGAACGCCGGCCGCCATCTCTGCCGCCCGTGTCATAACCG
TGAGAAAGCTCGAGGCCTAGGGAAGTACATCTGTCAGAAG
TGTCACGCGATCATCGAGGAGCAGCCCCTGATTTTCAAAA
ATGACCCCTATCACCCGGACCACTTCAACTGCAGCAACTG
CGGTAAAGAGCTGACCGCTGATGCCCGCGAGCTGAAAGGG
GAGCTCTACTGTCTGCCCTGCCATGATAAGATGGGTGTGC
CGATCTGTGGAGCCTGCAGACGGCCAATCGAGGGCCGAGT
GGTCAATGCCATGGGCAAACAGTGGCACGTGGAGCATTTT
GTCTGTGCTAAATGTGAGAAGCCTTTCCTGGGACACCGCC
ATTATGAGAGGAAAGGTCTTGCTTACTGTGAGACTCACTA
CAATCAGCTCTTTGGTGATGTCTGTTACCACTGCAACAGA
GTGATCGAAGGAGACGTGGTTTCGGCTTTGAATAAGGCCT
GGTGTGTGAACTGCTTCTCGTGCTCAACCTGTAACACCAA
ACTCACCCTGAAGAACAAGTTTGTGGAGTTTGACATGAAG
CCGGTGTGTAAGAAATGCTACGAGAAGTTTCCTCTGGAGC
TGAAGAAGAGGCTGAAGAAGCTGGCCGAGACTTTGGGCCG
CAAGTAAAACTCATCGTAATCATCATCTGTGCTCAAATCA
ACAGACCAAACCAAACCAAAGCGCAGATCATCTTGGAATA
GTTGTCTTACTTTATCCTACTTAAACTTTAAGTGTGTTTT
TCTACCACAGAAAGTATTGCAGGCAGATTTTTACTGGTTT
CACGCTAATGGATGCGCACGTGTCTTAAAAAAACCTGCAA
ACTAATCAAAACAGTTACCTTTATATTGTTAATGATAAAT
ATACAGTCGTGGAAAAAGGAGACTAATAAATCTTGAGAAA
CTGAGTATGGATTTGAGGAAAATGTTATTTGTTTTATTCA
ATAAAGGATTTCTGATAACATTTCTTTTAAACGTTAAATC
AAAATATTGTAAATAGCAAATTGCTAAGTGGTTAGAAAAA
AATAATGTCTTATTTTGTTGTCTAAAATTAAATGTAAACT
TGGCTGAAAATATGCCACTTTGTTATTTTAAGCAAAACAT
TTCATCTTAAAAATCAAAATAAATGTAATCAGACATTTAC
AGAATAAATACATTACCTGCCAACACTCCTGTTTTTTCCC
AGGAGTCTCCTGTATTTCCCATCTCCCGCCACCCTTCCCT
TTTGTTACTTTGCCCAGAAAACTCACGTAATTCCACCCCA
CCCCCTTTTTCTCATCTTTTGGTACAGTCTGTAACACCCT
TGGTGGTTAACTTTAGTAAAGTATCCGATCGCTGCAGCTG
CCCTTCTTTTTTTTGTTTTTTTTTCATCTATATTATAATA
ATAATAATAATAATTATTATTGTTATTATTATAATAATAT
AGATGCCATATTTTTGTTAGACATGTTAACATTATTTAGT
GTTAATTGCCAAGAAAACAGCATTTCATGAAATGACCCTG
TATTTAAAAAAATATTTCAATGATTGAAATTTTCTGAAAA
AAAAAAAAAAATAAATCTCTTTGATATTTGGAAGACATTA
TTAAACCTTTAAAGAACAATATGGAATTAAACCATACCTG
CCAACACTCCTGTTTTTCCCGGGAGTCTCTCGTATTTCAG
ACCCATCTCCCACCATCCTCCCATTTTGTTACTTCTCCCG
GAAAACTCAACAATCACGGCTGCAGCCCGCAGCTTGATGA
TGTAGTTGACTACTCCCCCATCCCCTATCAACTGTATAAA
CCCACACCAATACACCAACTATCAAGCCCCCACCCCAACC
CTGGTCTCCTGGAATTTCAGAGACAAATGTTGTCAAAAAC
TAAACTTGCTTTATTCAAACACGTCTATATTTTCATTTAA
ATCAGATTATTGGTGCCATATTTTGTTAGACATGTTGGTA
ACAGTTTAGTTTAGGTCACAATTCACGGTATTAACAAACC
ATTAACCAACGCTACTAGCTTAATAAACTACTAATTAAGT
GTTTATTAATAGTAATGTAGTAGTTGGGTTCAAGTTTTTG
TTAGGATTAGGGATGTAGAATTAGATCATACTTTATAACT
ATTGATGAACAGTTAATATCTTAATAGTAGGCGGGTAATA
TGACGGTTGTTAATTGCATGAATTGTGACCCAAACTAAAG
TATTACTGACTTGTTTAAATTAATTAAGTTTTAAGTGCTA
AGACGATAGAATTTAATGAAATAACCCTGATGTGTAAATC
TCTCTATTTGATATTTGAAAGGCATTATTAAACCTTTATA
GAATAAAACCAATATTAACACTTCACTTAAATCCTTGACC
CGACCCCCCCCCCCTACACCGGTATAAACGTACATGCATG
TTTATGAAGATAATGTTTGTATTGGCTGCGTTCAGACGGA
TTATTCGGCATGTTTTTGCTCTTTTCCTGAAGGCAGAAAC
TTGTGGTGTGTCTGACCGCAGGCCTGGCTTTGAAGCATCG
ATCTGAGAGATGTTTTTGATATTTAATGTATGCTCAGGCC
TTGTGTTTTTCTGTCAGAAAGGGGATCAAAAGTTAATGCA
TGATGTAATGAGCCTGGAGGAACAAGACAACCTCTAAAGC
AAAGTCTTCGCTCCACTGAACAAAGTGCTCTGGCTGTTTA
ATCTCCTTCTCAGCTTAAATTATCCAGCTTTATTAAAGCC
CTCACTGTGTTCTCCAAATATGCAATAAATTACACCGCTT
ATATTACTTCTGAGAGCTTTATGAACTGTGTTGCCAGTCT
TGCGTCATAACACCCTTGTCTTTTTCTATTTCGATTGAAA
GTTTAGTTTTTACGACCCGCCTGCCTTCTTTTATTATGAC
TGAGAAAATGCCTTGAAATATAATGAACTTGTGCCTTGTT
TTGTTATCTGCATTACTTTTGATGATTAATGAAACGATTG
ACTGAAGTCTGGAAGACTCTTTTTAAAAAGGCGATAATTA
AGATTTAACCTCACTACGTTTCTACTTTATATGCTTAAGT
TTTTTTTTTTTTTTTTTATCTTTGATTATATATTTAGCCA
TGTACTGTTCATGAAATGTCTTTTTACCGTTACGGTCAGC
AATATTGAGCAACAGCAAAACTGCTTTGTGCTTGTCTCCT
ATCACTGTCTGTATTCACTGAACGATGCATTTCAGCAAAA
TATGTATTGACAGGCTTGCTGGCAGCTTTTAAATAATACA
TTTCACCATGTTCTGTATGGAATATCAAAGTATATCAATA
AAGTATGCACTATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations