header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-3382
Transcript Name: lims1-201
Previous Name: lims1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061377 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061377|OTTDARG00000042528|ZDB-GENE-050522-236 lims1|OTTDARP00000047600 lims1-001 LG_ CU694209.13 Danio rerio protein_coding NOVEL, 3817 bp
CTCGGAAGCTCAAGCAGAGTGGACTGCGTTCTTTAGGAAA
ACATCTTTGTCTCCGAGAGAGAAGGGGAAAAAGTGGAAAA
GCAACAGATCGGAGGGGCGTCTTATGTTGTCGAAAAACAT
CTGAGTCGTCTTTCAGGATTAGCCGTGCTGAAGGGGATGC
TGGGGGTGTCAGAGATGACGGGCAGTAACATGGCCAATGC
CCTGGCAAACGCCTCATGTGAGCGGTGTAAAAGTGGATTT
GCCCCAGCAGAGAAGATAGTCAACAGTAATGGTGAGCTCT
ATCATGAGCAGTGCTTCGTCTGCGCCCAATGTTTCCAGCA
GTTTCCTGAAGGGCTCTTTTATGAGTTTGAGGGAAGGAAG
TACTGTGAGCATGATTTCCAGATGTTGTTTGCTCCCTGTT
GTCACCAGTGTGGAGAGTTTATAATTGGGCGTGTGATTAA
GGCCATGAATAACAGCTGGCACCCGGACTGTTTCTGCTGT
GATATCTGCCAAGCGGTGCTCGCCGATGTTGGATTCGTCA
AGAACGCCGGCCGCCATCTCTGCCGCCCGTGTCATAACCG
TGAGAAAGCTCGAGGCCTAGGGAAGTACATCTGTCAGAAG
TGTCACGCGATCATCGAGGAGCAGCCCCTGATTTTCAAAA
ATGACCCCTATCACCCGGACCACTTCAACTGCAGCAACTG
CGGTAAAGAGCTGACCGCTGATGCCCGCGAGCTGAAAGGG
GAGCTCTACTGTCTGCCCTGCCATGATAAGATGGGTGTGC
CGATCTGTGGAGCCTGCAGACGGCCAATCGAGGGCCGAGT
GGTCAATGCCATGGGCAAACAGTGGCACGTGGAGCATTTT
GTCTGTGCTAAATGTGAGAAGCCTTTCCTGGGACACCGCC
ATTATGAGAGGAAAGGTCTTGCTTACTGTGAGACTCACTA
CAATCAGCTCTTTGGTGATGTCTGTTACCACTGCAACAGA
GTGATCGAAGGAGACGTGGTTTCGGCTTTGAATAAGGCCT
GGTGTGTGAACTGCTTCTCGTGCTCAACCTGTAACACCAA
ACTCACCCTGAAGAACAAGTTTGTGGAGTTTGACATGAAG
CCGGTGTGTAAGAAATGCTACGAGAAGTTTCCTCTGGAGC
TGAAGAAGAGGCTGAAGAAGCTGGCCGAGACTTTGGGCCG
CAAGTAAAACTCATCGTAATCATCATCTGTGCTCAAATCA
ACAGACCAAACCAAACCAAAGCGCAGATCATCTTGGAATA
GTTGTCTTACTTTATCCTACTTAAACTTTAAGTGTGTTTT
TCTACCACAGAAAGTATTGCAGGCAGATTTTTACTGGTTT
CACGCTAATGGATGCGCACGTGTCTTAAAAAAACCTGCAA
ACTAATCAAAACAGTTACCTTTATATTGTTAATGATAAAT
ATACAGTCGTGGAAAAAGGAGACTAATAAATCTTGAGAAA
CTGAGTATGGATTTGAGGAAAATGTTATTTGTTTTATTCA
ATAAAGGATTTCTGATAACATTTCTTTTAAACGTTAAATC
AAAATATTGTAAATAGCAAATTGCTAAGTGGTTAGAAAAA
AATAATGTCTTATTTTGTTGTCTAAAATTAAATGTAAACT
TGGCTGAAAATATGCCACTTTGTTATTTTAAGCAAAACAT
TTCATCTTAAAAATCAAAATAAATGTAATCAGACATTTAC
AGAATAAATACATTACCTGCCAACACTCCTGTTTTTTCCC
AGGAGTCTCCTGTATTTCCCATCTCCCGCCACCCTTCCCT
TTTGTTACTTTGCCCAGAAAACTCACGTAATTCCACCCCA
CCCCCTTTTTCTCATCTTTTGGTACAGTCTGTAACACCCT
TGGTGGTTAACTTTAGTAAAGTATCCGATCGCTGCAGCTG
CCCTTCTTTTTTTTGTTTTTTTTTCATCTATATTATAATA
ATAATAATAATAATTATTATTGTTATTATTATAATAATAT
AGATGCCATATTTTTGTTAGACATGTTAACATTATTTAGT
GTTAATTGCCAAGAAAACAGCATTTCATGAAATGACCCTG
TATTTAAAAAAATATTTCAATGATTGAAATTTTCTGAAAA
AAAAAAAAAAATAAATCTCTTTGATATTTGGAAGACATTA
TTAAACCTTTAAAGAACAATATGGAATTAAACCATACCTG
CCAACACTCCTGTTTTTCCCGGGAGTCTCTCGTATTTCAG
ACCCATCTCCCACCATCCTCCCATTTTGTTACTTCTCCCG
GAAAACTCAACAATCACGGCTGCAGCCCGCAGCTTGATGA
TGTAGTTGACTACTCCCCCATCCCCTATCAACTGTATAAA
CCCACACCAATACACCAACTATCAAGCCCCCACCCCAACC
CTGGTCTCCTGGAATTTCAGAGACAAATGTTGTCAAAAAC
TAAACTTGCTTTATTCAAACACGTCTATATTTTCATTTAA
ATCAGATTATTGGTGCCATATTTTGTTAGACATGTTGGTA
ACAGTTTAGTTTAGGTCACAATTCACGGTATTAACAAACC
ATTAACCAACGCTACTAGCTTAATAAACTACTAATTAAGT
GTTTATTAATAGTAATGTAGTAGTTGGGTTCAAGTTTTTG
TTAGGATTAGGGATGTAGAATTAGATCATACTTTATAACT
ATTGATGAACAGTTAATATCTTAATAGTAGGCGGGTAATA
TGACGGTTGTTAATTGCATGAATTGTGACCCAAACTAAAG
TATTACTGACTTGTTTAAATTAATTAAGTTTTAAGTGCTA
AGACGATAGAATTTAATGAAATAACCCTGATGTGTAAATC
TCTCTATTTGATATTTGAAAGGCATTATTAAACCTTTATA
GAATAAAACCAATATTAACACTTCACTTAAATCCTTGACC
CGACCCCCCCCCCCTACACCGGTATAAACGTACATGCATG
TTTATGAAGATAATGTTTGTATTGGCTGCGTTCAGACGGA
TTATTCGGCATGTTTTTGCTCTTTTCCTGAAGGCAGAAAC
TTGTGGTGTGTCTGACCGCAGGCCTGGCTTTGAAGCATCG
ATCTGAGAGATGTTTTTGATATTTAATGTATGCTCAGGCC
TTGTGTTTTTCTGTCAGAAAGGGGATCAAAAGTTAATGCA
TGATGTAATGAGCCTGGAGGAACAAGACAACCTCTAAAGC
AAAGTCTTCGCTCCACTGAACAAAGTGCTCTGGCTGTTTA
ATCTCCTTCTCAGCTTAAATTATCCAGCTTTATTAAAGCC
CTCACTGTGTTCTCCAAATATGCAATAAATTACACCGCTT
ATATTACTTCTGAGAGCTTTATGAACTGTGTTGCCAGTCT
TGCGTCATAACACCCTTGTCTTTTTCTATTTCGATTGAAA
GTTTAGTTTTTACGACCCGCCTGCCTTCTTTTATTATGAC
TGAGAAAATGCCTTGAAATATAATGAACTTGTGCCTTGTT
TTGTTATCTGCATTACTTTTGATGATTAATGAAACGATTG
ACTGAAGTCTGGAAGACTCTTTTTAAAAAGGCGATAATTA
AGATTTAACCTCACTACGTTTCTACTTTATATGCTTAAGT
TTTTTTTTTTTTTTTTTATCTTTGATTATATATTTAGCCA
TGTACTGTTCATGAAATGTCTTTTTACCGTTACGGTCAGC
AATATTGAGCAACAGCAAAACTGCTTTGTGCTTGTCTCCT
ATCACTGTCTGTATTCACTGAACGATGCATTTCAGCAAAA
TATGTATTGACAGGCTTGCTGGCAGCTTTTAAATAATACA
TTTCACCATGTTCTGTATGGAATATCAAAGTATATCAATA
AAGTATGCACTATTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lims1-201 Contained in:
OTHER lims1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061377 (1)
  • Ensembl_Trans:ENSDART00000033980 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095840 (1) 2051bp
    GenBank:BC164372 (1) 1078bp
    GenBank:EH599986 (1) 941bp
    GenBank:EH593594 (1) 934bp
    GenBank:EH564945 (1) 923bp
    GenBank:EH543810 (1) 879bp
    GenBank:CT661205 (1) 838bp
    GenBank:EE302443 (1) 814bp
    GenBank:CT681764 (1) 799bp
    GenBank:CT647381 (1) 759bp
    GenBank:CT681582 (1) 744bp
    GenBank:CT621089 (1) 713bp
    GenBank:CT643706 (1) 652bp
    GenBank:AW174871 (1) 582bp
    GenBank:EB909301 (1) 515bp
    GenBank:AI722835 (1) 499bp
    GenBank:EH507581 (1) 378bp
    CITATIONS (2)