Transcript

nfatc3a-002

ID
ZDB-TSCRIPT-141209-3002
Name
nfatc3a-002
Previous Names
  • nfatc3-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059794 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059794|OTTDARG00000041465|ZDB-GENE-041111-41 nfatc3a|no_translation nfatc3-002 LG_ BX005082.7 Danio rerio protein_coding NOVEL, 909 bp
AGACTTTGCAGGTGGTGTTGGGGAGGGACTACAGACAGAC
TGACAGATGGATGACAGAAAACAGGGAACTGATACAAGCG
CGCACACACTCTCCAACAGAAAGTGAATGAGATCATCGGC
AGAGACATGTCTCAGGCCCCAGGGGCTCATGGAGGATCTC
CATCAGCACACAGTCAATCCTAGCCCTCCAAACACCACAG
TAAACTCTGACAATCCTCCCAGGACTGCAGCGCCGGCCTC
CAGTTTCACCCTGAACACACCAATCATCCAAAAACCATCA
ATCCTGAAGCAGTCTGAGCAGCAGTGGCCGCTTCCTCCAC
AATCATGAACACAGCTCGGCCTGTAAATGAGTTGGGGTAT
AAACTATACGCATGCACACAAAATCAGGTGTACCGTCAAC
ACACACATGCAGTGTGCTGTTCTCCTGGAAATAAACCAAT
AATTCAGGGCTCTCTGACAGGATGATGTATTATATGTAGC
TTGTAGACTGACCCTATGCATTTGAACGCCGACATATATG
CAGTCCACTCAAGGTGTGATGGGTGGCCACACGTCAGGCC
TTCTTACCAGCGAAAAAACGCTGCATTCTGCCAGTGCTGC
CCCCTAGAGGACTGGCGCTGAGTCTGTAGCGAGAAATATG
CAACATTCCAGGTGTTTAGTGACCTTTCTGAGCTGTAGAT
AATCTTGTTTAATAATTGGCCCGTTTCCTCTTCAGGTTGA
ACAAATGCCTTATGTAGTAGCAGTGATTTTGAACAGGCTT
TCTGCTGAGAACTTGTAGTCTTTTTACTTTTCAGTGAGGA
CGCCGCTGGTGTGTGTAAAATGTAGCCGAGCTTCATCTTG
TGTTTTGGAGTGCTGTGAATGGTGTTGGTTCGATCTTACT
GTCACAGTGCTGCGCTTTAAAAACAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations