Transcript

nfatc3a-201

ID
ZDB-TSCRIPT-141209-1780
Name
nfatc3a-201
Previous Names
  • nfatc3-001
  • nfatc3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059793 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059793|OTTDARG00000041465|ZDB-GENE-041111-41 nfatc3a|OTTDARP00000046436 nfatc3-001 LG_ BX005082.7 Danio rerio protein_coding NOVEL, 2619 bp
TGTTAATGATCATTTGGATTAACTCCAAGAAAAGAAAAGA
AATCTAAAATGTGACTTGGATGGACTTGTAGAGGGGATTT
TGGAAATGTTAAGAATACTCCTTCCTAATGTTTCTCCTTC
CTGATGTTTCTGCTGTGTTTGTCAGTATTGATTGTGCTGG
AATCCTGAAGTTGAGGAACTCTGACATCGAGCTGAGGAAA
GGAGAGACTGATATTGGACGGAAAAACACTCGGGTGCGCG
TGGTGTTCCGGGTTCACATCCCACAACCCAATGGAAAAGT
GGTCTCACTGCAGTCCTCATCAGTTCCAGTGGAGTGCTCT
CAGCGCTCAGCACAGGAGTTACCCCAAGTGGAGAAGGCCA
GTATCAGCAGTTGCCCAGTGAGTGGAAGAGAGGAAATGCT
CATCACTGGCTCCAACTTCTTCCCCGAGTCAAAGGTCATT
TTTCTGGAGAAAGGTCCAGATGGACGACCGCAGTGGGAGG
TGGAAGCAAAGATCATTAGAGAGAAGAGTCAAGGATCAAG
CATTGCGGTGGAGGTGCCTCCGTACCACAGTAAGACGGTC
ACTTCAGCAGTGCAGGTGCAGTTTTACGTGTGCAATGGAA
AGCGGAAAAGAAGCCAGTCGCAACGCTTCACCTATCTGCC
AGTCCTGGTCAAGCAAGAACATAGGGATGATCTGGACTCC
CCTGCCGTGCCGCCCATGTCAATGCCTCTGGTCCATGCTG
CCAGTTTGGTCTGCGCTCAGCCGCTGTCCTCCCCAGAGCA
CTCCCACCCACCAGACGGCCTTCTGTCCAGCTCCCCACGT
GGCCTGGCTGCAGGCCTGCACCCTCTCCAGGCCCCCTGCG
CCCCAATGGGCTCCCCAACTCTTCCCCACCTGCCCCACCT
TCAGGCTCGTGGGCTGAATGCACCTCCCGAATGCCAGATG
CCCTTCCACCCAGGCCCTGCTGCCACTGCCAGGCCATCTT
ACCCCCCCATACAGCACAACATGCCCTTCAATGGCCAGCA
GAGTCTTCCTATGACTGCAGGCTCCCCACAGGCCTACGAG
CGGATGCCCTTCCAGGCTGATCCAGCTGGGTGTCACACCC
TGGGTGTGGGGATGGTTTATGGCCCGGCTTCTTCAACACC
CCCCTCTGGAGTGCCGCCGGGTCCTGGCTCAAGCCCCAGC
CATGTAGCTTGTACAGGTAGTAACCAGGTCATGGCCCATT
CTGCCCCACACCTTCACTCTTTAGGCTATCACCACCCCAC
TCCAGGCCAGATACCATCGCCCACTCACACCCTGGGACAG
CCGCCCCCACAGCTCCAACGTCCACTGGTTTACCATCCAG
CCGGGCAGCGTTCTGCCTCCTGCCCCACGCCGTCCAGTGC
TCCAGCTCATATGGTGCCATCTCCCCACTCTGGGCCCTCA
TCCCCCCAGCTCCATTCGCTCCCATACCACTCGCCCACCT
CCCCTTCTCCTACATCCAACAGCCCCCTGGGGCCCATGGC
ACTCTCTGGACAGCCTTCGCCTCAGGCTAGCAGCCCTGTC
TTAGCTGGGTTGTCTCCTTCAGGTCCTTTGGCACACCCCC
TGGCCCAGCAAGGAGAGAGGCTGAACATCAAGCAGGAGCC
AGAGGACAGAGAGCCCACCTTCCGCACCATTGGCCTTCAG
GACATAACACTTGATGATGTGAATGAGATCATCGGCAGAG
ACATGTCTCAGGCCCCAGGGGCTCATGGAGGATCTCCATC
AGCACACAGTCAATCCTAGCCCTCCAAACACCACAGTAAA
CTCTGACAATCCTCCCAGGACTGCAGCGCCGGCCTCCAGT
TTCACCCTGAACACACCAATCATCCAAAAACCATCAATCC
TGAAGCAGTCTGAGCAGCAGTGGCCGCTTCCTCCACAATC
ATGAACACAGCTCGGCCTGTAAATGAGTTGGGGTATAAAC
TATACGCATGCACACAAAATCAGGTGTACCGTCAACACAC
ACATGCAGTGTGCTGTTCTCCTGGAAATAAACCAATAATT
CAGGGCTCTCTGACAGGATGATGTATTATATGTAGCTTGT
AGACTGACCCTATGCATTTGAACGCCGACATATATGCAGT
CCACTCAAGGTGTGATGGGTGGCCACACGTCAGGCCTTCT
TACCAGCGAAAAAACGCTGCATTCTGCCAGTGCTGCCCCC
TAGAGGACTGGCGCTGAGTCTGTAGCGAGAAATATGCAAC
ATTCCAGGTGTTTAGTGACCTTTCTGAGCTGTAGATAATC
TTGTTTAATAATTGGCCCGTTTCCTCTTCAGGTTGAACAA
ATGCCTTATGTAGTAGCAGTGATTTTGAACAGGCTTTCTG
CTGAGAACTTGTAGTCTTTTTACTTTTCAGTGAGGACGCC
GCTGGTGTGTGTAAAATGTAGCCGAGCTTCATCTTGTGTT
TTGGAGTGCTGTGAATGGTGTTGGTTCGATCTTACTGTCA
CAGTGCTGCGCTTTAAAAACAAAAAGTCAAGGGAATTGTT
GAAGGAATTATGTTGTTTTGTACAGTTGCACGGGACGATG
AGTTCCTGACCGCAGACCATCTGAAGGTCTGGAGATAATA
AAGCCCATATAGGATATATATAAATATATAAATATGAGCA
AATATGAAGAGTCCACTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations