ZFIN ID: ZDB-TSCRIPT-141209-285
Transcript Name: cyp51-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049301 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049301|OTTDARG00000034754|ZDB-GENE-040625-2 cyp51|no_translation cyp51-002 LG_ CU638710.17 Danio rerio protein_coding KNOWN, 539 bp
GTAACAAACCGCGGAGATGACGATCCTGGAGGTGGGCAGT
CAGCTGATAGAGAGCGCAGTTCTGCAGATGAGCCTGACTT
CAGTTCTGCTGACCGCGTCTGTGTTCACACTGACTCTGGG
ATACTTCAGCAAACTGCTCTTCACACAGCACAGCTCTGAA
CACACGAAGTATCCTCCTCATATCCCGTCCAGTTTGCCGT
TTCTGGGTCAGGCTGTGGCGTTCGGCAGGAGCCCCATCGA
GTTTCTGGAGAAGGCGTACGAGCAGTATGGTCCGGTGGTG
AGCTTCACTATGGTGGGAAAGACCTTCACCTACCTGCTGG
GCAGCGACGCGGCGGCTCTGATGTTCAACAGTAAGAATGA
AGACCTGAACGCCGAGGACGTTTACGCCAGACTCACCACA
CCTGTGTTCGGCAAGGGCGTGGCCTACGATGTGCCCAATC
CTGTAAGATACACACTCCTGAGACAAACATCCACACGCTT
TTACATCATCTACTACAGTCAGTATTAAACGTGTTATTAC
CCACCAGCTAAATAAATAA

cyp51 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cyp51-201 (1)    Ensembl 2500
ncRNA cyp51-002 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp51-002 Contained in:
[Fosmid] CH1073-440P11 (1)

Genome Resources: Vega_Trans:OTTDART00000049301 (1),  Ensembl_Trans:ENSDART00000171387 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR928553 (1) 539 nt
CITATIONS (2)