ZFIN ID: ZDB-TSCRIPT-141209-2728
Transcript Name: cyp51-201
Previous Name: cyp51-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049300 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049300|OTTDARG00000034754|ZDB-GENE-040625-2 cyp51|OTTDARP00000038684 cyp51-001 LG_ CU638710.17 Danio rerio protein_coding KNOWN, 2500 bp
GCAGCGAGCTCACATCAGGCGGGGGCGGGACTTTGATCAG
AGCTCCACACGGACGCGCAGGTATTAAAGTTATTAGATGT
ACATGAGATGTCAGTGTAGCTCGGAGACACTCAGACACAT
CTTCATCTGCAGTTAAATAGACAATAGTAACAAACCGCGG
AGATGACGATCCTGGAGGTGGGCAGTCAGCTGATAGAGAG
CGCAGTTCTGCAGATGAGCCTGACTTCAGTTCTGCTGACC
GCGTCTGTGTTCACACTGACTCTGGGATACTTCAGCAAAC
TGCTCTTCACACAGCACAGCTCTGAACACACGAAGTATCC
TCCTCATATCCCGTCCAGTTTGCCGTTTCTGGGTCAGGCT
GTGGCGTTCGGCAGGAGCCCCATCGAGTTTCTGGAGAAGG
CGTACGAGCAGTATGGTCCGGTGGTGAGCTTCACTATGGT
GGGAAAGACCTTCACCTACCTGCTGGGCAGCGACGCGGCG
GCTCTGATGTTCAACAGTAAGAATGAAGACCTGAACGCCG
AGGACGTTTACGCCAGACTCACCACACCTGTGTTCGGCAA
GGGCGTGGCCTACGATGTGCCCAATCCTTTATTTCTGGAG
CAGAAGAAGATGCTGAAGACCGGCCTGAACATCGCACAGT
TCAAACAACACGTGGAGATAATCGAGGAGGAAACCAAAGA
TTACTTCAGACGATGGGGAGAGAGCGGAGAGAGAAATCTG
TTTGATGCGCTGTCGGAGCTCATCATCCTGACGGCGAGTC
GGTGTCTGCACGGATGTGAGATTCGCAGTCTGCTGGACGA
ACGCGTCGCTCAGCTTTACGCAGATCTGGACGGAGGATTC
ACACACGCCGCGTGGCTGCTGCCCGGATGGCTGCCGCTGC
CCAGCTTCAGACGGAGAGATCGAGCACATCTGGAGATCAA
GAAAATCTTCTATAACGTCATCAAGAAGCGCAGAGAAGAT
ACCGAGAAACACGACGACATCCTGCAGACGCTCATAGACG
CCACGTACAAAGACGGCCGTCCTCTGAGTGACGATGAGAT
CGCGGGGATGCTGATCGGGCTGTTGTTAGCGGGTCAGCAC
ACCTCCTCCACCACCAGCGCATGGATGGGCTTCTTTCTGG
CGCGGGATCGAGCCCTGCAGGAGCGCTGCTACAGCGAGCA
GAAGAGCGTCTGTGGAGAAGAGCTTCCACCACTGCACTAT
GATCAGCTGAAAGACTTGAGTTTGCTGGACCGCTGCCTGA
AGGAGACGCTGCGACTGCGGCCGCCAATAATGACCATGAT
GAGGATGGCCAAAACCCCTCAGAAAGTGGGTGAATACACC
ATCCCGCCGGGACACCAGGTGTGTGTGTCTCCCACAGTAA
ACCACCGTCTGCAGGACACATGGGCTGAGCGGCTGGATTT
TGACCCAGACCGCTACCTGCACGACAACCCAGCGGCCGGA
GAGAAGTTCGCCTACATCCCATTCGGAGCAGGTCGCCATC
GCTGCATTGGGGAAAACTTTGCCTACGTGCAGATCAAAAC
CATCTGGTCGACTCTGCTGCGGATGTTCGACTTTGAGCTG
GTAGACGGACACTTTCCACCAGTCAACTACACAACCATGA
TTCACACACCGCACAACCCCATCATCAGATACACACGGAG
AAACACACAACCACAGCAGTGATGGAAACACTCACATCAT
TGCATTCAGATCAGCCTTTTCTTATTTAATATGTGGGTCT
CGCTTTACATTGAGCGTAATGCAGGCAGTGACATCAGCAC
ACAGCCAACAGTGCAGTCATTATGTGTTCAGTACAACACT
ACAGTTGCACATTGTTAGTTGATGTTAACTCGTGCTGCAT
TAATAATGTTTACAGGCTTGAGTTTGTATGTTAATGCATT
AGTGAATTCTGACCTCTGACTGATAAACGCTGTATTGAAG
TGTTGTTCATTATCAGTTCATGCCTGTAAATACAGTCACT
AATGAAAGCTTGCTGTAAAGCGTGACCCTTATGGGTTTTA
TTTGACCTTGAAGTGACCTGTGCTGCATAAACACTTATTT
TTGTATGATGGAAAGCCTGTAATGCACACTGTAAATCAAC
AGTTTCTGTGTTTTGGGTTTATTTATGGTTGTGAATTGCA
TTATGGGATGTTGATCTCTGCTCTGTCCACTTCTGATGTT
GAAAATTCAACTCTACAGTTTAACAAAGTGACTTTTATTG
ATGCTTTAGTAGTTTAAAATAATATAAGAATAATAATATC
TAGAGGAATAAGTGTGTAAAATAAGAGTAAATGTGCTGGA
GTTTATTATAAGGTTTCTGTAGCGTAATATACAACACCAA
CACACATTATATAACACTGCAGACTATTACACATGACAAT
AAAAGTCACGTTCTCAGACTTTTTTAGGTTAAAAGTTGCT
GGACGAAGGATCAAGATCCCACGATGCAATTTAAAAGCGT
AATAAACAAGGCAAAATACAGTGTATGAAAAGCTTTTAAC
AATAAACTCTTGATGTTTTA

cyp51 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cyp51-201 2500
ncRNA cyp51-002 (1)    Ensembl 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp51-201 Contained in:
[Fosmid] CH1073-440P11 (1)

Genome Resources: Vega_Trans:OTTDART00000049300 (1),  Ensembl_Trans:ENSDART00000062551 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC116552 (1) 2445 nt
GenBank:EE684503 (1) 832 nt
GenBank:EE322763 (1) 818 nt
GenBank:DV595680 (1) 774 nt
CITATIONS (2)