Transcript

cyp51-201

ID
ZDB-TSCRIPT-141209-2728
Name
cyp51-201
Previous Names
  • cyp51-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049300 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049300|OTTDARG00000034754|ZDB-GENE-040625-2 cyp51|OTTDARP00000038684 cyp51-001 LG_ CU638710.17 Danio rerio protein_coding KNOWN, 2500 bp
GCAGCGAGCTCACATCAGGCGGGGGCGGGACTTTGATCAG
AGCTCCACACGGACGCGCAGGTATTAAAGTTATTAGATGT
ACATGAGATGTCAGTGTAGCTCGGAGACACTCAGACACAT
CTTCATCTGCAGTTAAATAGACAATAGTAACAAACCGCGG
AGATGACGATCCTGGAGGTGGGCAGTCAGCTGATAGAGAG
CGCAGTTCTGCAGATGAGCCTGACTTCAGTTCTGCTGACC
GCGTCTGTGTTCACACTGACTCTGGGATACTTCAGCAAAC
TGCTCTTCACACAGCACAGCTCTGAACACACGAAGTATCC
TCCTCATATCCCGTCCAGTTTGCCGTTTCTGGGTCAGGCT
GTGGCGTTCGGCAGGAGCCCCATCGAGTTTCTGGAGAAGG
CGTACGAGCAGTATGGTCCGGTGGTGAGCTTCACTATGGT
GGGAAAGACCTTCACCTACCTGCTGGGCAGCGACGCGGCG
GCTCTGATGTTCAACAGTAAGAATGAAGACCTGAACGCCG
AGGACGTTTACGCCAGACTCACCACACCTGTGTTCGGCAA
GGGCGTGGCCTACGATGTGCCCAATCCTTTATTTCTGGAG
CAGAAGAAGATGCTGAAGACCGGCCTGAACATCGCACAGT
TCAAACAACACGTGGAGATAATCGAGGAGGAAACCAAAGA
TTACTTCAGACGATGGGGAGAGAGCGGAGAGAGAAATCTG
TTTGATGCGCTGTCGGAGCTCATCATCCTGACGGCGAGTC
GGTGTCTGCACGGATGTGAGATTCGCAGTCTGCTGGACGA
ACGCGTCGCTCAGCTTTACGCAGATCTGGACGGAGGATTC
ACACACGCCGCGTGGCTGCTGCCCGGATGGCTGCCGCTGC
CCAGCTTCAGACGGAGAGATCGAGCACATCTGGAGATCAA
GAAAATCTTCTATAACGTCATCAAGAAGCGCAGAGAAGAT
ACCGAGAAACACGACGACATCCTGCAGACGCTCATAGACG
CCACGTACAAAGACGGCCGTCCTCTGAGTGACGATGAGAT
CGCGGGGATGCTGATCGGGCTGTTGTTAGCGGGTCAGCAC
ACCTCCTCCACCACCAGCGCATGGATGGGCTTCTTTCTGG
CGCGGGATCGAGCCCTGCAGGAGCGCTGCTACAGCGAGCA
GAAGAGCGTCTGTGGAGAAGAGCTTCCACCACTGCACTAT
GATCAGCTGAAAGACTTGAGTTTGCTGGACCGCTGCCTGA
AGGAGACGCTGCGACTGCGGCCGCCAATAATGACCATGAT
GAGGATGGCCAAAACCCCTCAGAAAGTGGGTGAATACACC
ATCCCGCCGGGACACCAGGTGTGTGTGTCTCCCACAGTAA
ACCACCGTCTGCAGGACACATGGGCTGAGCGGCTGGATTT
TGACCCAGACCGCTACCTGCACGACAACCCAGCGGCCGGA
GAGAAGTTCGCCTACATCCCATTCGGAGCAGGTCGCCATC
GCTGCATTGGGGAAAACTTTGCCTACGTGCAGATCAAAAC
CATCTGGTCGACTCTGCTGCGGATGTTCGACTTTGAGCTG
GTAGACGGACACTTTCCACCAGTCAACTACACAACCATGA
TTCACACACCGCACAACCCCATCATCAGATACACACGGAG
AAACACACAACCACAGCAGTGATGGAAACACTCACATCAT
TGCATTCAGATCAGCCTTTTCTTATTTAATATGTGGGTCT
CGCTTTACATTGAGCGTAATGCAGGCAGTGACATCAGCAC
ACAGCCAACAGTGCAGTCATTATGTGTTCAGTACAACACT
ACAGTTGCACATTGTTAGTTGATGTTAACTCGTGCTGCAT
TAATAATGTTTACAGGCTTGAGTTTGTATGTTAATGCATT
AGTGAATTCTGACCTCTGACTGATAAACGCTGTATTGAAG
TGTTGTTCATTATCAGTTCATGCCTGTAAATACAGTCACT
AATGAAAGCTTGCTGTAAAGCGTGACCCTTATGGGTTTTA
TTTGACCTTGAAGTGACCTGTGCTGCATAAACACTTATTT
TTGTATGATGGAAAGCCTGTAATGCACACTGTAAATCAAC
AGTTTCTGTGTTTTGGGTTTATTTATGGTTGTGAATTGCA
TTATGGGATGTTGATCTCTGCTCTGTCCACTTCTGATGTT
GAAAATTCAACTCTACAGTTTAACAAAGTGACTTTTATTG
ATGCTTTAGTAGTTTAAAATAATATAAGAATAATAATATC
TAGAGGAATAAGTGTGTAAAATAAGAGTAAATGTGCTGGA
GTTTATTATAAGGTTTCTGTAGCGTAATATACAACACCAA
CACACATTATATAACACTGCAGACTATTACACATGACAAT
AAAAGTCACGTTCTCAGACTTTTTTAGGTTAAAAGTTGCT
GGACGAAGGATCAAGATCCCACGATGCAATTTAAAAGCGT
AATAAACAAGGCAAAATACAGTGTATGAAAAGCTTTTAAC
AATAAACTCTTGATGTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations