Transcript

traip-201

ID
ZDB-TSCRIPT-141209-2753
Name
traip-201
Previous Names
  • traip-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000050914 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050914|OTTDARG00000035748|ZDB-GENE-040801-30 traip|OTTDARP00000039985 traip-001 LG_ FP102275.4 Danio rerio protein_coding KNOWN, 2096 bp
GGAGGAGTCATTAGGTTTGAACTCGGCGCGCCGCTTAAGT
CAAGTCGGAAGCTCAAAAAGAACTACAGACAAACAATATA
AACACAATTATGGAGTTTAATTAAGAAAAATTCCATTCAC
AAGACATTTCATGCGTTTCAGTATCACCTGGATCAACAAT
GCCCATTCGAGCATACTGCACAATCTGCTCAGATTTCTTC
GACCATTCTAAAGATGTGGCTGCAATTCACTGTGGCCATA
CCTTTCACTATAGCTGTCTTCTCCAGTGGTTTCAGTCAGC
CCCAAACAAAACTTGTCCACAATGCAGAAAACAGGTCAGC
ACACGGCACATAATTAACAAGCTGTTCTTTGACATCGCCC
CAGAGGATGATGGGGCGCCAGTGGATCCTGAAAGTTTACA
GAATGAGCTCGATCGCATGAAAGCAGTGCTGTCTGAAAAA
GAGAAAGAATGGAGGGAAAAGCAGAAGACAGTTGACACTT
TAAAAGACACAATTGAGAAGCAGAAGAAGGATCTGGATAA
AGTCCGGAAAGAAATTGGTGATAAAGAGATGCTGTGTTCC
GTTCTCCGGAAACAGATGAATTTCTTGGAGAGCCAGAAAA
ATGAAGGACAGGCAGCAAAGGAGGAAGCCAAGCGGCTCCG
AGTCAAAATGAAAACCTACGAGAGTTTGGATGTTGTCCTT
CAAGGCCAGAGGTCAGAGGTGGAGGCCATGATCACTGATA
TGGGTGTTGGTCAATCTGCTGTTGAACAGTTGTCTATATA
CTGCATCTCACTTAAAAAGGAGTACGACAATCTGAAAGGA
AGCCTCAAATCATCAAATGAGATGTGTGAGAAGCTAAAAA
GGGAAATGATCTCTTCTAACAGCAAGTTGCAGAAAGCCAC
TTCAGAGACAAACAGGACAAAGGAGGACATGAAGGCACTT
CAGAAAGATCTGTCCAGCGCAGACAAAGAGATCACGAGTT
TGAAGAAGAAGGTGGAGATTCTTCAGCGAACGTTAAGCAC
TCCAACTCGCACTAACGAGGCTATCAGTAGATTAGTGTTT
GAAAGCCCTGCACCTCTGGAGCTGAAGCCTCCTGGTCATG
GTCACATGACAGACTCTCAGGAAATTGACCTCAACCTGAC
GTTTGACATTAACACCCCTGAACATGTGGAGAAGAAACCC
GTTCAGGTGCCCAAGAAGATGCGTCTGGATCCTTCAGTAT
CCTCTTCAACACAAAACACAGAAAATACACAAGGCCGAAA
TAACGGTCGTGTTAAAGATGATGATGTCATGATGGGATCC
TTGTTTAGAAACTCGCTGCTCTTTAGAAAGAATGCATTTG
GAAGCATGCTGGACCCCTGCAAATCTGGCACTGTAAGATC
CGGCTATGATGGGCTCGGAGGAAGAGCCAAATTCATCCAA
CCCTCTCCTCTTTCTGAGATTCGACCTCTTGTCTTAAAGT
CTAAGAGGAAGAAGGTCTCCAGGCCTGTTACAAGCAAACC
CACCTCCAGCCTGACTACTCTGGACGGGTTCTTGGAATAA
AACATCACCCTTTTGAGGCCCAAGAGAGAACATTGATTTC
CCATGATGCCACCCAGAAATGCATTACGGGAAATGAACAT
TCACAGATGCTTTAATAAGGAAAGTGGTCTTCGTGAATGC
TTGTGGAGCTGCTGATAAATGCAAAACACTTTTTAGCGCT
AGCTTTGGTAAATTTTCAATAGAGACTGAAAATGGAGTCT
AATGCGAGACTGTGTTTGTGGAAAAATCTGTGCGTTTATC
TTGATGAGTTTTTCAGCTTGGACAGATTGAATGGTGCCAT
CGGGTAGTGGATGCCTTATAATATGCTGAATTTTACTAGT
CGAAAGAGTTATTTATTTGACTTGCTTGCCATCAAAATTA
AACAGGGCTGCATTTCTGTCTTTGTATTTTCAAGTGTCTT
TAGGTTAGAATTTATGTCTATCTTTTGTTTGTTTTCTGTT
TCGTTTCTTCTCTAAATAGTTTGATATATCAAATATTGTG
TTTGTTTTTAAAAATTTCTTTGTTTGAGATTAGTTTTTTC
TTGTGTCTGTACAGATGATTATTATGTGAAACAATAAACT
ATAGTTTTTATTAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations