Transcript

psma8-201

ID
ZDB-TSCRIPT-141209-2658
Name
psma8-201
Previous Names
  • psma8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044987 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044987|OTTDARG00000032249|ZDB-GENE-040426-2194 psma8|OTTDARP00000035572 psma8-001 LG_ CU861664.8 Danio rerio protein_coding KNOWN, 1235 bp
ACATCCTATGCGCTCGGTGATTGCGCACGCGCAGATCAAT
TTCGAAACCTCCTGTGCTGTGCTGCTAGTCGAAAGTCAGA
GGCAACTATTTCACAGCAATTCGCGCTTTTGTGTCTAGTG
TGCAGAAATGGCAGCTAGATACGACAGAGCTATAACAGTT
TTCTCTCCAGACGGTCACTTGTTTCAGGTGGAATATGCGC
AGGAAGCAGTAAAGAAGGGCTCCACAGCTGTTGGAATCAG
GGGAAAAGATATTGTTGTGCTGGGTGTTGAGAAGAAGTCA
GTGGCGAAGCTTCAGGAAGAGAGGACGGTCAGGAAGATCT
GTGCTTTGGATGAACATGTGTGCATGGCCTTCGCAGGTCT
GACAGCAGATGCCAGGATTGTGATCAACAGAGCACGAGTA
GAGTGTCAGAGCCACAGACTCACAGTGGAAGACCCCGTAA
CTGTGGAGTACATCACCCGCTACATCGCCACACTCAAACA
GCGCTACACTCAAAGCAATGGACGTCGTCCGTTCGGCATC
TCGGCCCTGATTGTTGGTTTCGACTATGATGGGACCCCAC
GTCTCTATCAGACAGACCCTTCTGGAACATACCACGCATG
GAAGGCAAACGCCATCGGCCGCAGTGCGAAGACGGTGAGG
GAGTTTCTGGAGAAGAACTACACAGATGAAGCCATCGCCA
GTGATAATGATGCCATCAAGCTGGCCATCAAAGCCTTACT
GGAGGTTGTGCAATCCGGGGGCAAGAACATCGAGCTGGCA
GTGATCCGAAGAAACCAGCCCCTTAAGATTCTGGAGTCCA
AAGAGATTGAGACGCTGGTCGCCGAAATAGAGAAGGAGAA
AGAGGAGGAGGCAGAGAAGAAGAAGCAGAAGAAGTCTTCG
TAAATCAGATTCTCTCTTGGTTTTGTTTATATGGGCAGAT
GCACTTGGCTCAGGCTCTCACTGTACACCTTCCTCCTCCT
CTTCATCTGTTAAGAGCACAGACTCTTGGTCTTCTGCTGA
ACCACGGCATCAATGAATATGTTTGTTTTTTTTCCCCAGG
AAATATTTTTAAGATCCTAGTAATCAAAGCATGTTCAGGG
ATGAGAGCTGCCAGTTGTTCATTTGTTGAGCATGTACTGT
GGTCAGCCTCTTGATTTTGGTCAGTTTTCTTGCTCAACTT
TCGACCACTGCTCAGAATTCTGGGAGAATGTGCTCTGACT
GATGTTTCCTAATAAACTGTTTTGGTTTGTACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations