Transcript

psma8-002

ID
ZDB-TSCRIPT-141209-212
Name
psma8-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044988 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044988|OTTDARG00000032249|ZDB-GENE-040426-2194 psma8|no_translation psma8-002 LG_ CU861664.8 Danio rerio protein_coding KNOWN, 783 bp
TGTGCTGCTAGTCGAAAGTCAGAGGCAACTATTTCACAGC
AATTCGCGCTTTTGTGTCTAGTGTGCAGAAATGGCAGCTA
GATACGACAGAGCTATAACAGTTTTCTCTCCAGACGGTCA
CTTGTTTCAGGTGGAATATGCGCAGGAAGCAGTAAAGAAG
GGCTCCACAGCTGTTGGAATCAGGGGAAAAGATATTGTTG
TGCTGGGTGTTGAGAAGAAGTCAGTGGCGAAGCTTCAGGA
AGAGAGGACGGTCAGGAAGATCTGTGCTTTGGATGAACAT
GTGTGCATGGCCTTCGCAGGTCTGACAGCAGATGCCAGGA
TTGTGATCAACAGAGCACGAGTAGAGTGTCAGAGCCACAG
ACTCACAGTGGAAGACCCCGTAACTGTGGAGTACATCACC
CGCTACATCGCCACACTCAAACAGCGCTACACTCAAAGCA
ATGGACGTCGTCCGTTCGGCATCTCGGCCCTGATTGTTGG
TTTCGACTATGATGGGACCCCACGTCTCTATCAGACAGAC
CCTTCTGGAACATACCACGCATGGAAGGCAAACGCCATCG
GCCGCAGTGCGAAGACGGTGAGGGAGTTTCTGGAGAAGAA
CTACACAGATGAAGCCATCGCCAGTGATAATGATGCCATC
AAGCTGGCCATCAAAGCCTTACTGGAGGTAAACAACACAT
TCCCTTAGTTACATGTTCACAACACACACTCATGTCATGA
AGCTGGCAGGACGCAACATGTTTGCTGAGGCAGTTGTGTG
TGATCTGTGCTGCACAGGTTGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations