Transcript

ottdart00000022287

ID
ZDB-TSCRIPT-141209-2520
Name
ottdart00000022287
Previous Names
  • rhoga-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022287 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022287|OTTDARG00000018385|ZDB-GENE-040426-1504 rhogd|OTTDARP00000018683 rhoga-002 LG_ BX000526.8 Danio rerio protein_coding KNOWN, 3589 bp
GTAAGATACGATGACACACCATCTTCACTGATCTGAGGAG
CAGGAGGGCAAAGTGCCACTGCCTGTTTGGATGCAGAATG
CAGACGATTAAGTGTGTGGTGGTGGGAGACGGTGCGGTAG
GCAAGACATGCCTTCTTATTTCTTATACGACAAATGCCTT
TCCAGAGGAGTACATTCCCACAGTGTTTGACAACTACAGT
GCTCAGATGAGTGTAGATGGGCGCACTGTCAGCCTCAACC
TCTGGGACACGGCAGGGCAGGAGGAGTATGACCGTCTGCG
CACGCTTTCTTACCCACAAACTAATGTTTTCATCATTTGC
TTTTCCATCGGAAGCCCTTCATCATTAGCTAATGTTCGCC
ACAAGTGGCACCCGGAGGTGTCTCACCACTGTCCCAACGT
GCCAATTCTTCTAGTTGGCACCAAGAAGGATCTGCGTTCA
GATACAGAGACAATTAAGAAGTTGAAGGAGCAAGGGCTTG
CACCCTCTACTCAACAGCAGGGTGGCACCCTGTGCAAGCA
GATCAATGCTGTGAGGTATCTGGAGTGCTCGGCGCTCCGC
CAGGAAGGCGTGCGGGATGTGTTTGTAGATGCTGTTCGTG
CTGTGCTCTACCCAATGACCAAAAAGAATACCAAGAAGTG
TGTTCTCTTATAGTCGGCTGTACATCGGGGACTGCTGGAG
GAGTATAATTTTATTAACAAGCTGACCCTTTTATTTGTGT
AATTTTTTTTTTCTGTGTCTCACTGACTTTCTCCTGCTAA
CATAAGTACCTTTCGTTTTTGTATTACTTGTAGATCAGTC
TGCCAAAGTTATTCGCCTATTTTTTTATGATAATAGAAAA
CAGATTATTTTCGGATGCTCAATGAAAGATATTTTTATAT
ACAGATTAGCGGTGACCATGTCCATGATTAGCAAGTATGT
AGAGTGGGATTTTTGCTTGATAATGACCTTGACTGTGCAT
TCTGATTAATGTGCAATTTAATGAAGACTGACTGAGACAG
ACACTTTAGGTTTCCCTTCCAATTCTTTGATAAGCCCCTT
AAAGTCTTTTTTTCTGTAGCTGTTCTATTCCCACAAAAGC
AATATTTCAACCAGTTATAAAAGGATACGTGTTTTTCCAA
AATCAGGTTTATCAAAAGATAAAGTTGTTTAGAGATACAA
CACCTTAGGAGCATTCTGATATCTGTTATTCACAATCGCC
AGCTGTTAAAAACTTATTTCCATAATGCAAAAATGAAACC
TTGATTTTTATTTATTGATAATTATTTTTAGTTTCATGCT
GTACAGTTTACAAAAAAAAAATCCTAATAGTCTTACATAT
TTTAGGGATGAAAAATAACTCCAATATCTAGTGAGATTTA
CCTGTGCCTTTAAGAATTGTGTCTTATGTGCTTTTTTTTT
TTTTTTAAAGCTGCCTACCATGGCTAAGCAAGTAATATAT
TACTATTTTTATCAGATTTGAGCAGCATCCCATTTTCTTG
TTAGATTTTTTTTCTTATGAAGCAATTATTTACTCAAAGC
TTACTGAAGTTCAACTTTTAGTTAGAGTTTGGTCTTATCT
GCCATGCCCATTCCTAGGATTCACCCTGTATTTTATGCAG
CACAAGAGTTGTTTGTCAGTTGTTTTTATTAGATCCGTCA
TTCCTATGACCAAGTGAATGTCTCACACCGGCTGCACTGT
GTGATACATGAACAGGGATTTGTCTTTCAAACCCAAAGAA
GACTGAGCTGCAGGCATGCGTGGCTTCTGTCGTTTTAACC
CGCTGGGTCCAAAGTTCAAACCTGCACTAAGATGAGTGCT
ATTTGCTTCTGTTTGCTTTGGAGAAAGAAGGACTCCAAAC
TACAGGATATATATACCGGCTGCTTTATTAGGTACACTGT
ACTAGATGGACCCCTTTTGCCTTCAGAACTGCCTTTATAT
TTCTAGGCATAGATTCAACAAGGTACTGGAAATATGCGAT
GCGAATCTTCTGTTCCACAACATCTCAAAGGTGCTCTATT
GGATTGAGATCTGGTGACAATGGAGGCCATTTGAATATAG
TTAACTTATTGTCATGTTCAAAAAACCGGTCTGAAATTAG
TTGCGCTTTGACATGGCATGTTGTCCTGCGGGAAGTAGCT
ACCTGGTCTGATCTTGTGCTGCTGTAGCCCATCCACTTCA
AAGTTTGATGTGTTGTACGTTCAGAAATGCTTTTCTGCAT
ACCTCGATTGTACCAAGTTTCTATTTAAGGTACTGTTGCT
TTCTATCAGCTCAAACCGATCTGGTCATTCTCCTCTGACC
CCTGGAATCAACATCTCTGTAAACCCTAGAGATGGTTGTT
TGTGAAAATCCCAGTAGATCAGCAAGTTCTGAAATACTCA
GACCAGCCCTTCTGGCAAAAACAACCATGTTCAAACGTTC
AAAGTCACCTATAACACCTTTCTTCTTCATTCCGATGCTC
AGTTTGAAATGCAGCAGATCTTATTGACCATGTCTACATG
CTTAAATGCATTGAGTTGCTGCCATGTGGCTGGCTGATTA
GAAATTTGCGTCAATGAGCAGTTGGACAGGTGTACCAAAT
AAAGTGGCCGGAGAGTGTGTACTGTATATGAATAGAAATG
TGTCATTTCGATATATTTGTTTGGATAGGGAGGGATTTTA
TTTTTACTATAAACCAAGGGTTATTTTATACTGCTTTACA
TGATGAATATGAGGGTATAAGTTGTCTGTCATGTTACCTG
ACAACACTGGCCACTGTTTTTTAGTATCAGAGTTTTCAAA
ATGTGGGATACCTCCCCATGTTGCTAACATCATGCCGTAA
GTGACTACATTGATCGTGGTCAAAGTAATTGTTGTAGGCA
GTTGATGAACTGCAGCTATGTATGGGGTTATAATGTGTTA
TTTAACTCCATGGAACAAGAGCTTTTTGTGCTTTCATAAC
TGGAAGTTGCCGTTGTGCTAAACTGACATCAATGAATCAC
CGTGTAGTGTGAAAACCGAGGCTGTGGAAACCTGTGATTT
TATAACTGATTGTCATTTATGTTTTTTTATATTGCCTTGC
ATTGAAAACCTTTAGCTTTTTAAAATTGTCTGCCAAAGTG
CCTTTGGATACAGAGATTTTCTGTGCAGGTTGATGTTTGA
ATCACACCTTTTATGATTTACAGTGATGTTTGTTTCTGAT
GACGTAATTCCTGTTTTGATTTGAATAACGTGTTGCTGAA
CCTGATGTGTTGTTTGCTGAGATGAAAAAGAAATGGAAGG
GAAATGCTCTTAGTGATGAAGTGCGCTAATGTGGATATCA
TGATTGGATATCATGAATGTGGGTATCATGATTGACTGTG
TGCAGTGAATGATGGGTGAACTATTTAATATAGTTAATAT
ACTGTTTTGTAGTTTCTGTTTCATCTTTTTAACCTTGCAT
ACTTTCATTAACAGACAGTTGGCTTCACTAATCATATTGG
GATGTGGTGCTTCATTTACACTGTGCTAAATTCATGCACT
GGGATCTCAATTTGATCAAAATTGCCATTTTTATTACAAA
AAATAGTTTGAACTCACCTTGAAATCATTTCAAACTAATG
CCAAATAAACGTTTATGTATCAAATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations