Transcript

rhogd-202

ID
ZDB-TSCRIPT-090929-18102
Name
rhogd-202
Previous Names
  • rhoga-001
  • rhogd-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037702 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037702|OTTDARG00000027867|ZDB-GENE-040426-1504 rhogd|OTTDARP00000030224 rhoga-001 LG_ BX927254.15 Danio rerio protein_coding KNOWN, 3535 bp
AACTCCAGTCGGAGGGGTGCAAGGCTTTCAGAGGCGGTGC
CACTGCCTGTTTGGATGCAGAATGCAGACGATTAAGTGTG
TGGTGGTGGGAGACGGTGCGGTAGGCAAGACATGCCTTCT
TATTTCTTATACGACAAATGCCTTTCCAGAGGAGTACATT
CCCACAGTGTTTGACAACTACAGTGCTCAGATGAGTGTAG
ATGGGCGCACTGTCAGCCTCAACCTCTGGGACACGGCAGG
GCAGGAGGAGTATGACCGTCTGCGCACGCTTTCTTACCCA
CAAACTAATGTTTTCATCATTTGCTTTTCCATCGGAAGCC
CTTCATCATTAGCTAATGTTCGCCACAAGTGGCACCCGGA
GGTGTCTCACCACTGTCCCAACGTGCCAATTCTTCTAGTT
GGCACCAAGAAGGATCTGCGTTCAGATACAGAGACAATTA
AGAAGTTGAAGGAGCAAGGGCTTGCACCCTCTACTCAACA
GCAGGGTGGCACCCTGTGCAAGCAGATCAATGCTGTGAGG
TATCTGGAGTGCTCGGCGCTCCGCCAGGAAGGCGTGCGGG
ATGTGTTTGTAGATGCTGTTCGTGCTGTGCTCTACCCCAT
GACCAAAAAGAATACCAAGAAGTGTGTTCTCTTATAGTCG
GCTGTACATCGGGGACTGCTGGAGGAGTATAATTTTATTA
ACAAGCTGACCCTTTTATTTGTGTAATTTTTTTTTTCTGT
GTCTCACTGACTTTCTCCTGCTAACATAAGTACCTTTCGT
TTTTGTATTACTTGTAGATCAGTCTGCCAAAGTTATTCGC
CTATTTTTTTATGATAATAGAAAACAGATTATTTACGGAT
GCTCAATGAAAGATATTTTTATATACAGATGCGGTGACCA
TGTCCATGATTAGCAAGTATGTAGAGTGGGATTTTTGCTT
GATAATGACCTTGACTGTGCATTCTGATTAATGTGCAATT
TAATGAAGACTGACTGAGACCGACACTTTAGGTTTCCCTT
CCAATTCTTTGATAAGCCCCTTAAAGTCTTTTTTGTAGCT
GTTATATTCACACAAAAGCAATATTTCAACCAGTTGTAAA
AGGATATGTTTTTCTCCAAAATCAGGTTTATCAAAAGAAA
AAGTTTAGAGATACAACACCTTTTAAGGAGCATTCTGATA
TCTGTTATTCACAATCGCCAGCTGTTAAAAACTTATTTCC
ATAATGCAAAAACGAAACCTTGATTTTTATTTATTGATGA
TTATTTTTAGTGTCATGCTGTACAGTTTTTTTTTTCAGAT
ATATATTTTTTTATTTTACAAAAAAAAAGTCCCTTTTAAG
AATTGCCTCATGTGCTTTTTTTTTTTTTTTTAAAGCTGCC
TCCCATGGCTAAGCAAGTAATATATTATTATTTTTATCAG
ATTTAAGCAGCATCCCATTTTCTTGTTAGATTTTATGAAG
CAATTTTTTACTCAAAGCTTACTGAAGTTAAACTTTTAGT
TAGAGTTAAGTCTTATCTGCCACACCCTCAGCCTGATTCC
TAGGATTTACCCTGTATTTTATGCAGCACAAGAGTTGTTT
GTCAGTTGTTTTTATAAGATCCCTCATTCCTATGACCAAG
TGAATGTCTCACACCGTGCACTGTGTGATACATGAACAGT
GATTTGTCTTTCAAACCCAAAGAAGACTAAGCTGCAGGCA
TGCGTGGCTTCTGTCGTTTTAACCCGCTGGGTCCAAAGTT
CAAACCTGCACTAAGATGAGTGCTATTTGCTTCTGTTTGC
TTTGGAGAAAGAATGACTCCAAACTACAGGATATATATAC
CGGCCGCTTTATTAGGTACACTATACTAGATGGACCCCTT
TTGCCTTCAGAACTGCCTTTATATTTCTAGGCATAGATTC
AACAAGGTACTGGAAATATGCGATGCGAATCTTCTGTTCC
ACAACATCTCAAAGGTGCTCTATTGGATTGAGATCTGGTG
ACAATGGAGGCCATTTGAATATAGTTAACTTATTGTCATG
TTCAAAAAACCGGTCTGAAATTAGTTGCGCTTTGACATGG
CATGTTGTCCTGCGGGAAGTAGCTACCTGGTCTGATCTTG
TGCTGCTGTAGCCCATCCACTTCAAAGTTTGATGTGTTGT
ACGTTCAGAAATGCTTTTCTGCATACCTCGATTGTACCAA
GTTTCTATTTAAGGTACTGTTGCTTTCTATCAGCTCAAAC
CGATCTGGTCATTCTCCTCTGACCTCTGGAATCAACATCT
CTGTAAACCCTAGAGATGGTTGTGCGTGAAAATCCCAGTA
GATCAGCAAATTCTGAAATACTCAGACCAGCCCTTCTGGC
AAAAACAACCATGTTCAAACGTTCAAAGTCACCTAAAACA
CCTTTCTTCCTCATTCCGATGCTCAGTTTGAAATGCAGCA
GGTCTTATTGGCCATGTCTACATGCTTTAATGCATTGAGT
TGCTGCCATGTGGCTGGCTGATTAGAAATTTGCGTCAATG
AGCAGTTGGACAGGTGTACCAAATAAAGTGGCCGGAGAGT
GTGTACTGTATATGAATAGAAATGTGTCATTTCGATATAT
TTGTTTGGATAGGGAGGGATTTTATTTTTACTATAAACCA
ATGGTTATTTTATACTGCTTTACATGATGAATATGAGGGT
ATAAGTTGTCTGTCATGTTACCTGACAACACTGGCCACTG
TTTTTTAGTATCAGAGTTTTTAAAATATGGGATACCTCCC
CATGTTGCTAACATCATGCCGTAAGTGACTACATTGATCG
TGGTCAAAGTAATTGTTGTAGGCAGTTGATGAACTGCAGC
TATGTATGGGGTTATAATGTGTTATTTAACTCCATGGAAC
AAGAGCTTTTTGTGCTTTCATAACTGGAAGTTGCCGTTGT
GCTAAACTGACATCAATGAATCACCGTGTAGTGTGAAAAC
CGATGCTATGGAAACCTGTGATTTTATAACTGATTGTCAT
TTATGTTTTTTTATATTGCCTTGCATTTGAAAACCTTTAG
CTTTTTAAAATTGTCTGCCAAAGTGCCTTTGGATACAGAG
ATTTTCTGTGCAGGTTCATGTTTGAATCACACCTTTTATA
ATTTACAGTGATGTTTGTTTCTGATGACGTAATTCCTGTT
TTGATTTGATTAACGTGTTGCTGAACCTGATGTGTTGTTT
GCTGAGATGAAAAGGAAATGGAAGGGAAATGCTCTTGGTG
ATGAAGTGCGCTAATGTGGATATCATGATTGGTTATCATG
AATGTGGGTATCATGATTGACTGTGTGCAGTGAATGATGG
GTGAACTATTTAATATAGTTAATATACTGTTTTATAGTTT
CCGTTTCATCTTTTTAACCTTGCATACTTTCATTAACAGA
CAGTTGGCTTCACTAATCATATTGGGATGTGGTGCTTCAT
TTACACTGTGCTAAATTCATGCACTGGGATCTCAATTTGA
TCAAAATTGCCATTTTTATTACAAAAAAATAGTTTGAACT
CACCTTGAAATAATTTCAAACTAATGCCAAATAAACGTTT
ATGTATCAATTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations