Transcript

sv2ba-201

ID
ZDB-TSCRIPT-141209-249
Name
sv2ba-201
Previous Names
  • sv2ba-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046877 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046877|OTTDARG00000033345|ZDB-GENE-070209-134 sv2ba|OTTDARP00000036908 sv2ba-001 LG_ CR848709.18 Danio rerio protein_coding KNOWN, 4646 bp
CCATAATCCTCTGGTCTGCCCAACAGCCTCCTGTTAAGGT
GACATGTAGGGCTTGCCTTCTGAAACTCTGCCAGGATTTT
CCTTTGGATTTTAATTTATATCAGCAAGGAATTATAATTC
TGGTGCAATGTGGCCTTGTGCGGAACCAACCAAAGGGAAA
TAGTTCATTATCATCAAAAAACACTGAGGCCTTAATTTAA
CTGAGGTGCATTTTATATCAACAGACCATCTTGGATTTGC
ATCTGTCACCAAAAGCTCTTGGGTTTTCTGAGGATTATGC
TCATTTAGCATTTTTCTGGTCTACAAAATAAGAATAACAC
GTTTCAAGCCAAAATGGATGACCCTTACCAAAACAATATA
AACCAGCAGGGAGAAGCATATCCAACATATGGGGAGGGAG
GAGAATACACTTACCCCTATCAAACAGACTATCCACGCCA
GGAAGAGGATGATGCTGCTAGTGATGCCACCGAAGGCCAT
GATGAGGATGATCAGATGTACGAGGGAGAGTACCAGGGTG
TCCCACATCCAGATGAGATCAAGGAAGCGCGGAGAGCAGC
CCGAAGGGAGGCCCGGATGAAGGCCAGAATGGCAGCAGAG
GTGGAGGAGGAAACATTGCCAGATCAGTATGAAAGCATCA
TGGAGGACTGCGGTCACGGACGCTTTCAGTGGACCCTCTT
CACCGTGCTGGGTTTGGCCCTGATGGCTGACGGTGTGGAG
TGTTTCGTAGTGAGTTTCGCTCTGCCCAGTGCTGAGAAAG
ACATGTGCCTGTCCAATGCAGACAAGGGCATGCTGGGTTT
GATAGTGTACGTGGGGATGATGATCGGTGCTGTTGTTTGG
GGCGGTCTGGCTGATAAACTGGGCAGAAAGCAGTGTTTAC
TCTACGCACTGGCCATCAACTGCATCTTCTCCTTCCTGTC
TTGTTTTGCACAAGGCTATGGCTTCTTCATCTTCTTCAGA
CTCTGTTCAGGGATCGGGATTGGCGGGTCAATTCCAGTCG
TCTACACATATTACGCTGAGTTTCTACAGATGGACAAGAG
AGGAGAACATCTCAGCTGGCTGTGCTTGTTCTGGATGCTG
GGAGGACTGTACGCTTCCTTCACTGCATGGGGAATCATCC
CACATTATGGCTGGGGGTTCAGTATGGGCACCGAGTTCCA
GTTCCACAGTTGGAGGGTGTTTGTTCTGGTTTGTTTCCTT
CCCTCTGTGGCTGCTCTCGCAGGGCTGGTGTTCATGCCAG
AGAGTCCTCGTTTCCTTCTAGAGAGTGCAAGACACGATGA
GGCCTGGATGATCCTGAGGCGAGTCCACGACACCAACTGG
AGAGCCAAAGGAGAGCCCGAAAGAGTCTTTCAGGTTTCTC
AGATTAAAACACCTCAAACACAGGATGACGAGTTCATAGA
GATTCAGAGTGAAACTGGCACTGCCTTCCAGAGATTCATG
GTCAGACAGATGACCCTGGTTAAGCAGGTGATGAAGAACA
TGTTGTCATTGGCTGCACCTGATGTCAGACTCCATGGTTT
GTTCATTGCCATTGTGTGGTTTACTATGGCCTTCAGTTAT
TACGGCCTAGGCACGTGGTTTCCAGACCAGATCAAGTACC
TCCAGTTTGAAGAGTACGAGTCCAACGTCAAGATCTTCCA
CCGTGAGAGAGTCGAACGCTTTCATTTCAACTTCACTCTG
CAAAATCAGCTCCACAAAGAGGGGGAGTATGTTCACGACA
GGTTTATCAACATCGAAATAAGAAATGTGAAGTTCGAGGA
TTCGCTCTTTGAGAATTGTTATTTTGAGGACATCAAATCA
ACAGAGACCTTCTTCGAGAACTGCACCCTGAAAAACACAG
TCTTCTACAATACCGACCTGTGGGAAGATTCCAAGTTCAT
TAACTGTAACCTGGAAAACACAACGTTTTTGCACCCCAAA
AAAGGCTGCCATCTCAATTTCCAGGAGGAAAATGACATCC
TGATCTATCTAGACAGCTTCCTGGGCAGTTTGTCTGTAAT
ACCAGGCAACATCTTAGCAGGTCTATTAATGGATAAAATA
GGACGACTTAAAATTATAGGAGGATCCATGTTAGGCTCTG
CCGTCTGCACATTCTTCCTGCTCCTGTGCTTCAGTCAGTG
GGCTGTGGTTCTGTTCCAGTGCCTCTTCTTTGCAGCCGGA
GCTGCAGCTTGGAACGGCATCGAGGTCGTTACAGTGGAGC
TCTATCCAGCCTCAAAAAGAGCCACAGCTTTCGGTGTGCT
GAACGGCACATGCAAACTGGCAGCTATCATTAGCAGTTTC
ATCTTTGGCAAGTTCATTGGCATCACCAAGATTATACCTA
TAATCCTGTCCTTCTCAGCGCTGGTCTGCGGAGGGCTCCT
AGCATTCAAGCTACCTGAGACTCGAGAGGTCATTCTTCAG
TGAAAATAAAAGCCAAACTCTTCAAGGCCTCAGTATTTTG
GTCTAGATGGACACGGGATGATTAGCCTGCTGGACACTGA
CTGCAAAAAAAAAAAGGCTGGAAAGATAAGATATGGTGTC
ATGGTAGATTCAGTGTACTGCAGGGTTACTTTAATAGTAT
TACTTCTTTAAGTTGTAGAGCATGTTTAAAGGAACACTTC
ACTTTTTTGAAAATAGACCTAATTTACTACCTCCCAAGTT
GAATTTTACTGCTTTTTAATTCTTTCAGCTGATCGCTGGG
TCTGGAAGGAGCACATTTAGCTTAGCTTAGCATAAATCAT
TGAATTGGATTAGACCATTAGCATCTCACTCAAAAATTTC
CAAAAAGGTCTTAATAAATTTCTTATTTAAAGCTCGACTC
TGAAAATAGTGTCCAGTTAGGTAGCTACAGTAGGTAACAG
CATAACCATGGTAACCATGGTACTGCAGCAAGATCTCTTG
ATTATTACGCCAGAATGAGAAAGTATTTCCTAGCCATATC
AGCCTAGAAAATAGCAACTTTTCACTTTCTGGTGATCTTA
GTACTTGATACAACTTTTTACTTTAAAAAGTTAAACAGTT
AAGTTTTACTATTTTCTAATCTATACAGCCGATATCCGGG
TCTGGAGAAAGCACATTTAGCTTAGCTTAGCATAAATTAT
TGAATCAGATTAGACCATTAGCATCTCACTCAAAAATTTC
CAAAAAGGTTTCAACAAATTTGTTCTTTAAAGCTCGACTC
TGAAAATAGTGTCCAGTTAGGTAGCTACAGTAGGTAACAG
CATAACCATGGTAACCATGGTACGGCAGCAAGGTTTCTGG
ATTATTACGCCAGAATGAGAAAATAGTTCCTAGCCATATC
AGCCTAGAAAATAGCAACTTTTCACGTTCTGTTCATCTTA
GTACTTGATATAACTTTTTACTTCAATAAGTTAAAGGGTT
GAGTTTTAAACCTTTTTAGTCGATCTGCGGGAATTGAGGG
CACACAATTAACTTAGCTTAAAGCATTGAATTGGATTAGA
CCATTAGCATCTCATACAAAATAATAAAAAAAAGGTTTTG
ATAATTGCTTATTTAAAGCTTGGCTCTGAAAATAGTCTCC
AGTTAGGTAACTATAGTAGGTAACAGCGTAACCATGGTAA
TCATGGTACAGCAGCAAAGTTCCTTGATTATTGCGCCAAA
ATAAGAAGATTCCTAGCCATATCGGCCTAGAATAAAGCAA
CTTTTCATTTTTTTAGTCCACCTTTGTACACAATCTAAAT
ACAAAAGAGTTACGCTTTAAACAGGAAAAGTAGCGCAAGC
CTTTTTGGGAATTTTTTGAGCATGATGCTAATGGTCTAAT
CTGATTCAATGATTTATGCTAAGCTAAGCTTAAAGTGCTC
CCGGCAGACCCAGAGATCGGCTGAATGGTGACTTGTATAA
GCTTATTCCCCCAAAAAAGTGGAGTGTTCTTTTAAATTGT
ATATTGTGTGTAAAAAAAATAAATATAGGGAAATTCCTTT
GCTACAGTGAAATCAAAAGAGCGTAGCAGTGAGTGCTGAC
ATCGAATTCCCTTTTTATATCAAAACAAATCATAACGTTG
ACTGTTAAGTTCTATCTTTAAAATAAAAATGTGCGTTTTA
CTTTTTATTTGTTTTTCTGTAAAGAAGATAAATCTTTATC
TCCAATTGTATCCGTTCACTAGCTTTCAGTCATCAGCTAG
ATTTTTGTTGTGTTGTATTTGTTTACTACTGTGGTAAGGT
ATGTGTTTATTTCACATTAGATAAATATATTTTATCGTGT
TTTAACGTTCTTCGGATTCCCATCTTTTCAACTATTGTTT
GTCATGCCTTTTCAGTAGAAGATGATCATATCACAGCAAA
TTGACATTGTTTGTATGAAAATAGACATTTTTAAATTGTA
TGTGTATGTAACGTGTGTATAATTCTAAGGAGGAAACAAT
GTAGATTATTAAAATAGTTAATATAAGGTAATGGCTCCAA
ATAATGATTGAATTATGCCAATGATTCTGTTGATGTTTTG
TCCACATCTGACCAAAGAAAAGGCCATTTAAATGTATTTT
TAAGAGGACATCTCTAAAGCAAAAAGGGGCTCTATAGCAA
TAGCTTTAAGTATATATTAAATGCTTCTTTTTATATATCA
TTTTCAAAAGTCTAAGTAAGAAAAGATTGGTTTATGTTGT
TTTGTTTTTTTGATGGTATAAATAATAAAATATAAGTTAT
AATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations