Transcript

sv2ba-002

ID
ZDB-TSCRIPT-141209-2252
Name
sv2ba-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061662 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061662|OTTDARG00000033345|ZDB-GENE-070209-134 sv2ba|no_translation sv2ba-002 LG_ CR848709.18 Danio rerio protein_coding KNOWN, 645 bp
CGATTAGTCAGCGCTGACCTTTGTTTACATGTGCATGTGC
TGGCAATTTTCTCTCATTGTAAAACGATGAGTGCTGAGAG
GATGATGTTTGATAGTGTACGTGGGGATGATGATCGGTGC
TGTTGTTTGGGGCGGTCTGGCTGATAAACTGGGCAGAAAG
CAGTGTTTACTCTACGCACTGGCCATCAACTGCATCTTCT
CCTTCCTGTCTTGTTTTGCACAAGGCTATGGCTTCTTCAT
CTTCTTCAGACTCTGTTCAGGGATCGGGATTGGCGGGTCA
ATTCCAGTCGTCTACACATATTACGCTGAGTTTCTACAGA
TGGACAAGAGAGGAGAACATCTCAGCTGGCTGTGCTTGTT
CTGGATGCTGGGAGGACTGTACGCTTCCTTCACTGCATGG
GGAATCATCCCACATTATGGCTGGGGGTTCAGTATGGGCA
CCGAGTTCCAGTTCCACAGTTGGAGGGTGTTTGTTCTGGT
TTGTTTCCTTCCCTCTGTGGCTGCTCTCGCAGGGCTGGTG
TTCATGCCAGAGAGTCCTCGTTTCCTTCTAGAGAGTGCAA
GACACGATGAGGCCTGGATGATCCTGAGGCGAGTCCACGA
CACCAACTGGAGAGCCAAAGGAGAGCCCGAAAGAGTCTTT
CAGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations