ZFIN ID: ZDB-TSCRIPT-141209-2336
Transcript Name: bmpr1ab-201
Previous Name: ottdart00000061919

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061919 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061919|OTTDARG00000042847|ZDB-GENE-040912-150 bmpr1ab|OTTDARP00000048426 bmpr1ab-001 LG_ BX957331.5 Danio rerio protein_coding KNOWN, 3258 bp
CAACTAGAGAAAAAAGAACGAAAGAAACAGGAGAAAACGT
TCTCGAAAGAGAGAAAAATCACATAGAACCACACCAGGGA
AACTCTTTATTATTCACGCTTTGAAGTAGATTTTCGTCAC
GTGCCATAAGCCCTGATTTGGAAGGCTTTGGACTGTTTTA
GCAGCTTCATCAAATAGGTTTTTACAGGAGTTAGTGGCTT
CAGCTTAAGACAGAAGGACTCTGTAAATACTGACACTGAT
GAGTACACTGGATCATCATGTACTGCAACGTTTGCTACCC
TGTCAGGGTTTTCCACAAGAGGAGACTGTAAAGAGGCCTT
AGAGAAGTCTTCATACTCTTACCGTGTCCATTCATCTTCA
CAACTGATTGGATACTTCAGTAATTCAAAAGTGGTGCAGT
ACATCACGACCAACACAGCCATACAGTTCAACAACTCGAC
CTTCATGATGAAAAGCACCTTCACGATCATCGTCTTTGGC
GTTTTAGTAGCTGCTGTCCTCCTCTCACCATTGGCCGAGG
GGGGACAGAACCCAGACTACATGCTTCATGGCACTGGAGT
CAAGCCTGGATCAGATCCAAGGCGAGCTCAGGCAGGAGAC
GGGTCCACCGTGGCCCCAGAGGATGCTGCCCGCTTCCTTA
GCTGCTACTGTTCAGGCCACTGCCCAGAAGATGCCACAAA
CAACACCTGCGAGACAAACGGCCATTGTTTTGCTATCATA
GAGGAGGATGAGCACGGCGAGGCGATGCTGACCTCAGGCT
GCATGAAGTACGAGGGATCCCACTTCCAGTGCAAGGACTC
TCCTAATGCTCAGACCAGACGGACCATTGAGTGCTGCTCC
ACAGATTTCTGTAATAGAGACCTACAGCCCACACTTCCAC
CTCCTATTCCAGGAAAGCCTCCATTTTGGAACGCCCACTT
GCTGGCTTTTCTGATCTCTGTGACAGTGTGTTGCTTCACT
TTGGTTGCCATTACTATAGTGTGCTACTACAGGTTTAAGC
TGCAGACGGGACGGAGACATTATCAGAGGGATCTGGGGCC
GATTGAGGCCTTTATCCCTGCAGGAGAGTCTCTCAAAGAT
CTTATTAGTCAGTCCAGCACTGGCTCTGGGTCAGGGCTCC
CCCTGCTGGTTCAGCGCACCATCGCTAAACATATTCAGAT
GGTACGTCAAATCGGAAAGGGTCGTTATGGAGAAGTGTGG
CTTGGCCGCTGGAGAGGAGAAAATGTGGCGGTGAAAGTGT
TCTTTACTCGTGAAGAGGCCAGCTGGTTCAGAGAGACTGA
GATTTACCAAACCGTGCTCATGAGGCATGAGAATATACTC
GGCTTCATAGCTGCAGATATTAAAGGCACAGGAACGTTCA
CTCAGCTTTTCCTCATCACAGACTACCATGAGAATGGATC
CCTCTGTGACTATCTGAAATACACTACCCTGGACACACAG
GCTCTGCTGAGACTAGCATACTCTGCCGCCTGCGGTCTGT
GCCACCTCCACACAGAGATCTATGGCACACAGGGCAAACC
TGCCATCGCTCACAGAGACTTGAAGAGCAAAAACATCCTC
ATTAAAAAGAACGGCACATGTTGCATCGCTGATCTGGGCC
TGGCTGTCAAATACAACAGTGATACCAATGAGGTGGATGT
CCCTTTAAGTACAAGGATGGGCACGCGGCGATACATGGCA
CCAGAGGTCCTGGATGAAACCCTAAATAAGAACCAATTCC
AAGCATACATAATGGCTGATATTTACAGCTATGGTCTCAT
TGTTTGGGAAATGGCCCGTCGATGCGTCACAGGAGGTATT
GTTGAGGAGTATCAGTTGCCATACTGGGACATGGTACCCT
CAGAACCATCCTATGAGGACATGAGGGAAGTGGTATGTGT
TAAAAGCATGCGGCCAGTGGTGTCTAATCGCTGGAACAGT
GACGAGTGCTTACGAGTCATGCTAAAACTTATGTCTGAAT
GCTGGGCCCACAATCCAGCCTCACGCCTCACAGCTCTTCG
TGTCAAGAAATCACTCGCCAAAATGGTTGAATCACAAGAC
ATCAAAATATGAGCAGTACTCGCTGTGCTGCCAGTCTGAA
AGAAATCAAGGAGATACATGTGCTCACTTTGTGAATTACT
GCTTCAGTTCCTAACCAGACCTATGGGGGCACTGCTGAGC
AGAACTTTTACCTCCCCTTCTGGCCATATTTCCTCACCCA
TGTTGCAGTTATGCTCTTAGTGTCATGTAGCACTCTCTGC
TGGACAGTATGTGCCATAACGCATCTATGGGGAACCAAGG
ACGAAAAGGACAACTTATCTACAGGCATCGGTACTAACAT
CAGCCCCATCGCCACTATGTTTTCTATTTTCAGGAACTCT
TATGTTTTAGGAGAGAACTGAAAAGCATATGGTGCTTTCT
GTGAAAGCCATGAAATACGATACTTTGGTATGGAGGACTA
GCATGATTTGTCATGGGAGCGCAGTAATGGAGCCATTCGG
GAGCCAAGGTTTAAGCAAATGACTTGAACAGTGGACATAT
TTGGGGTGATTTTTGGACTGGACCCCATCCATATTCTTGG
GATGTGCTGTGTTGTGGTTAACAACTCAAAATGGACACTG
CATTTGAGCGATGTGTTGTAGTGGCCACCGAATTGCAGCT
CAATTGAAATCAAACGACCCATATTATCATATATATGTAT
AAAACAAACGAACAAACAAAAGCTTCCCTTTAGCTACATA
TTGATATTTAAATTTAATAGCCTTTTTGAAGACTTATTCC
TTCAGTTGATTACATTCTGAGCAACAATCCATTAGATCTG
TCCTAACGAAGAGGTTTTCTAGTGGAACCCTTCCCATTTT
TTGAAGACTAGAAATGCATTCACCGATTATATACAGAAAG
TTCATGACTGATGTGATCATAACTCCAGCTCTGGCCCCAA
GTGTTGAAGTACCACCAGTCAAATATTGCCAACACTGCAG
CTATAAAAGATCTGTTAATCTAGAAGATATGGTGACTTTC
AATCTTTTGGAGTGGCAGATCTGACCCGGCTTATTGCAGA
TGTGTCGGTGCAAATGGATGCCCACTGCTCCCAAATGCCT
CGTAACCATTGTGTTATTTTATCCAATCGCCTTCAAGTCA
GTCCCAGTATATCACATCTGATTTGCCCGTTTCAGATTGG
ATTGCTGTTTGCATTGCCTCATTTAAACAGTTTTGCCTTG
AATCTAATGTTGTGACGCTTGGGAATTATATGACTCATAA
ATGTCTAATGTGATAGAA

bmpr1ab TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bmpr1ab-201 3258
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bmpr1ab-201 Contained in:
[BAC] CH211-103O20 (1)

Genome Resources: Vega_Trans:OTTDART00000061919 (1),  Ensembl_Trans:ENSDART00000166769 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC081626 (1) 3277 nt
CITATIONS (2)