header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2313
Transcript Name: sft2d2a-201
Previous Names: ch73-29l19.3-001, ottdart00000061849

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061849 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061849|OTTDARG00000042800|ZDB-GENE-050227-13 zgc:110788|OTTDARP00000048368 CH73-29L19.3-001 LG_ CU915768.9 Danio rerio protein_coding KNOWN, 905 bp
GAATGAAGGGAGATGAAGTTAAAGGTGAGCAGTGATGTCG
TGCGAGAGTGCCTGTTGAACGATGATACAACACATTCTCA
GAGATTTGGAGTGAATTAATTAGTGGATATAAAGAATTAA
GAGTTCAATAATGGACAAACTCAGAGCGGTTCTGGGTGGT
CGGGATGGAAACAATGATAACAGGAACATACTGCAGGCGG
CGAATGAAGCGTCCACACTGGGATGGGGAACGCGCGTGAA
AGGATTCGTTGGTTGTTTGGTCGTTGGAGTAGTGTTCTCT
ATCTTGGGAGTAGGTTGCCTGTTTATTCCCAAAATTGGGA
TACTTCTTTTTGTTGTGTTTTATACATTGGGAAACGTTTG
CTCCTTAGCAAGCACCATGTTTTTAATGGGACCAGTGAAA
CAGCTGAAACGCATGTGTGACAAGACCAGAGCCTTTGCTA
CTGTTGTGATGATAACATGTCTGGTTCTCACACTCTGTGC
AGTATTTTGGTGGAAGATCTTTGCTCTCACTCTGCTGTTT
GTCATTCTTCAAGTCCTTGCATTTGCATGGTATGGCCTCT
CATACATCCCTTTTGCAAGGGATGCTGTACTGAAGTTTTT
CTCCATGTTGTGCAACATGTGTATGAAATGAAGAGCTGAT
GTTTATCCTTTCATCACTCTGGGAACTGGGAACACTCTGC
TCAAGTATTCTGCAATTCTGGGGTCCACAAATAATCACTG
AGACTATGGGATGGTGCTAGTTGTAATCGCTAACGTTAGC
TGGACGACATGCTAAATCTGACTGTACAAAAGATTACATT
TTACTGAATGTGTTTTAAATGTGTTGTAAAACAGATTTGT
AAATGTTATGAAATGTCTTAAAATTGATATTTATTAAAGT
AGATATTGCAGTTATATACTAAAAA

sft2d2a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sft2d2a-201 905
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sft2d2a-201 Contained in:
[BAC] CH73-29L19 (1) (order this)

OTHER sft2d2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061849 (1)
  • Ensembl_Trans:ENSDART00000104160 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090293 (1) 930 bp
    GenBank:CO958373 (1) 829 bp
    GenBank:CK682028 (1) 827 bp
    GenBank:BI673509 (1) 647 bp
    GenBank:BI672732 (1) 548 bp
    CITATIONS (2)