Community Action Needed: Please respond to the NIH RFI
Transcript

ptger4a-201

ID
ZDB-TSCRIPT-141209-2272
Name
ptger4a-201
Previous Names
  • ottdart00000061724
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061724 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061724|OTTDARG00000042722|ZDB-GENE-060222-1 ptger4a|OTTDARP00000048275 ptger4a-001 LG_ CT027631.14 Danio rerio protein_coding KNOWN, 1352 bp
AAAATGCCTGCTTAGCGCGATCTCCAGACTCCCAGCGCGT
CCAGCAGCAGCATGGAGCCCACCGTGCCCACCATCCCCGC
CATCATGTTCATCTTCGGGGTCATCAGTAACCTGATCGCC
ATCGTGGTGCTCTGCAAGTCCCGCAGAGAGCAGAAGGAGA
CCACCTTTTATACCCTGGTGTGCGGGCTGGCGGTCACGGA
TCTCCTGGGCACCGTGTTGGCCAGCCCGGTCACCATCGCC
ACCTATGTGAAGGGCGCGTGGCCGGACGGGGACCCGCTGT
GCCAATATTTCGGCTTCGTGCTGCTGTTTTTTTCGCTCGC
AGGATTGAGCATCATCTGCGCCATGTCCATCGAAAGATAC
ATCGCAATCAACCACGCGTATTTCTACAATGATTACGTGG
ATAAGCGGCTCGCGGGGGTCACCCTACTCGCCATTTACGC
ATCGAATATACTGTTCTGCGCGCTTCCAAGTGTCGGCTTC
GGCGAGGTGAAAATGCAGTATCCTCAAACCTGGTGCTTTA
TTGACTGGCGGACCAATGTGAGCGCGCACGCGGCGTTCTC
TTACATGTACGCGGGCTGCAGTTCTCTGCTCATCCTGGTC
ACGGTGGTCTGCAATGTGCTGGTGTGCGGCGCGCTCATCC
GCATGCACCGCCGCTTCGTCAGGCGCACGTCTCTAGGCAC
TGACCCACAGAGAGCCGCCGATCCCGGCAGGAGCCGCAGC
TTCAGCCGCCTGGCCGGCGCGGAGATCCAGATGGTCATCC
TGTTGATCGCCACCTCCGCAGTCGTGCTCATCTGCTCAAT
CCCGCTTGTTGTCCAGGTGTTTCTCAACCAGCTTTATAAG
ACTCCAGTGGAGAAGCGTCTGGATAAAAACCCAGATCTTC
TGGCCATCCGCTTCGCCTCCACCAACCCCATCCTGGACCC
GTGGATCTACATCTTACTGCGTAAAGCGGTCCTGTCCAAA
GTGGTGGAGAACATCAAGTGTTTGTTCTGCAGGAGCGACT
CTCGCGGCCAGCAAACCCAAAACAGCCTGCTGTGTATAAA
CGGCCAGCAGTTTTCCTCCAGAGACTCTCCGTCTGCTGTG
TCCCGCGAGCTCCAGGACGTCAGCAGCACCTCTCAGACTT
CATTAAACCTGGCGAAAGCTCCTGACGGCGGGCAGAACTC
CAGCAGTGAATCCTGTAGATGCAGCAGCCATGATGGTCAA
TGCAAAAAGCAGAGCTTACAGATGAGCATCACTAACGACA
GCGTCCAGGAGAAGAGCATCTGAGAGTAGCTTATATCACT
TTATTTATTGGAGAAAATCACACTGTAAATGAGCATTGCT
TTTGAGGAATTAAACTAACTACACTCCAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations