Transcript

dlg2-202

ID
ZDB-TSCRIPT-141209-2185
Name
dlg2-202
Previous Names
  • dlg2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061446 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061446|OTTDARG00000031087|ZDB-GENE-050221-3 dlg2|OTTDARP00000047890 dlg2-002 LG_none BX470178.13,CT956004.5,CU207267.27,CU862079.7 Danio rerio protein_coding KNOWN, 586 bp
GGAGTCAAGAGGAACTGATACTCTCATATGAGCCTGTCAT
CAGACAAGAGATTAATTACGCCAGACCAGTTATAATCTTG
GGGCCCATGAAGGACCGAATCAACGATGACCTCATCTCTG
AGTTCCCTGACAAGTTTGGGTCATGTGTGCCACATACTAC
CAGACCAAAGCGGGATTATGAAGTGGATGGGAGAGATTAT
CACTTTATGGCCTCTCGAGAACAGATGGAGAAAGACATCC
AAGAGCACAAATTCATTGAGGCTGGACAGTACAATGACAA
TCTGTACGGAACCAGCGTCCAGTCGGTCAAATACGTGGCT
GAGAGGGGTAAGCACTGCATACTTGACGTGTCTGGGAATG
CCATAAAACGACTACAAGTAGCACAACTCTACCCCATTGC
CATCTTTATAAAGCCTAGATCCATTGAGTCCTTAATGGAA
ATGAATAAGAGGTTGACAGAGGAACAGGCCAAAAAGACAT
ACGACCGTGCCATGAAACTGGAGCAGGAGTTTGGCGAGTA
CTTCACAGCGCTGGTTCAAGGAGACACACTAGAGGACATT
TATAACCAGTGTAAGATGGTGATAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations