Transcript

sec24c-004

ID
ZDB-TSCRIPT-141209-2183
Name
sec24c-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061440 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061440|OTTDARG00000040832|ZDB-GENE-030131-4487 sec24c|no_translation sec24c-004 LG_none CU694198.14,CU469520.4 Danio rerio protein_coding KNOWN, 528 bp
CAATGGGATCGCAAGGCCCTACAATGGCACAAGTTAATCA
TGTACCCCCTTCACAACCTGGTATGCCACCTGGTCCTATT
AATGCTTCCCTGTCAGGGCCACCACCACAGCCGGGAATGC
AGGGATATCCTCCTCAGCAAAATGGTGCTTTCGGGCAAGT
CAGAGGTCCTCAGCCTGGCTATGCAGCACCACCATATTCT
GGCCAGCCAAACTATGGAGCACCACCCGCTGCACCTGCCC
CAGCACCAGCTGCCCCAAAGAGACTCGATCCTGATTCTAT
CCCAAGCCCGGTATGAACTTTCCACATCTGACATACACCT
GACATACACAACAAGCTCATTCTCCACCATTCCCTTGCAC
TGTTTTGAAGTTAATGTTTTTATCCACCATGTTCAGTACT
AATGCACTTCCATACACAATCATACACATAACCGTATAGT
GTCAGTCAGTAATAAAGGATATTTATGTACATAGATCTGT
GATGTGCTTGTGTTAAAAGGCTTCGCTCTGGAGTCTCCTG
TGTCTGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations