Transcript

sec24c-204

ID
ZDB-TSCRIPT-130528-733
Name
sec24c-204
Previous Names
  • sec24c-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058901 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058901|OTTDARG00000040832|ZDB-GENE-030131-4487 sec24c|OTTDARP00000047851 sec24c-003 LG_none CU694198.14,CU469520.4 Danio rerio protein_coding KNOWN, 484 bp
GGCTCAGTTCTTCCGGTGCGCGTGAGGAAGGGATTAAACG
TCCGTCTCGCTGCTCTCTTTCCGTGAAAGAACGGCAGCCC
ACCCGCGTTTACCGGCGTTTCAAACCGGAACGGAGTACTG
ACGACTCGTTCGTTAACCAATCAAGCAGTTTGTGAGATTA
GGGATGAACTGAGAATGAATGTCAACCAGCAACCTCACAT
GGCCTCTCCTTATGGGCAACCTCAGCCAGGGTATCAGCGC
TACCCTCAGCCAGGGTATCAGCGCTACCCTCAGCCAGGGT
ATCAGCGCTACCCCCAGCCTGGATACGGGGGTGGCCATGT
GCCATCGGGATATCCAGCTCAGTATGCACCAGATAACGGC
CCGGGCTCTGGCTACCAACAAGGTCCACCGCAAGGATATT
CTCCTTATGCAAGCTTTCCCTCTAAGACTCTCACAACAAA
CTTAGTCTCTGACCTGTCCTCCTCCTCTCCTCTTGACTTA
GGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations