ZFIN ID: ZDB-TSCRIPT-141209-2181
Transcript Name: sorbs1-008
Previous Name: dkey-103j14.2-008

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061434 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061434|OTTDARG00000029663|ZDB-GENE-090313-168 sorbs1|no_translation DKEY-103J14.2-008 LG_none BX546482.15,CR356222.25 Danio rerio protein_coding NOVEL, 619 bp
GTTTTCCCCGCTAACTTGCATGCAGGCCAAAATACTTGCT
TACTTGTCCACGCTACGCTTCGTCCGGAGGACCTAAGAGT
TTCAGAGCTTTGAAGGCAGCAGACGTTCTCAAGCCTGACT
GACTAATGCGCCTTCTCCCTTTCCAGCTGCCAGAGAGTCA
AGCCTTTGGAGCTATCAATGACTTCTTTGTTTGGTTTGTT
GCAGAGTGCCCCCTCTTTCAGCCCCCTGGAAACATCCTCC
GACCTACAGCAATACTCATCCTGTAAAGTGAGTGACGGTG
AAGCAGAGAAGAAGGACGGCTCGTCCGGCAGCGGGTCGGC
AGCTCCAGAATGTGAACGACACATTTACAAGAGCGTCCTG
GAGGGCGGCGACATCCCACTGCAGGGCCTGAGAGCGCTAA
ACAAACGCCACCCCAGCACTTCTTCCAAAGACTCAGACTC
TTCACATCCATTAAGCCAAGGAGATCATGGAGAAAGCACA
GATGAGGCTGTCCGGAAACGCCACGGAGATAAAGAGAAAA
TTCTGGAAGAGCAGAGACGGCTGAAGCGAGAGCAGGAAGA
GGCAGATACAGCTGCTCGGAGACACGCTGGGCTGGTTGTG
ACTCATCAACAGTTCATTA

sorbs1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sorbs1-202 (1)    Ensembl 6034
sorbs1-203 (1)    Ensembl 579
sorbs1-204 (1)    Ensembl 582
sorbs1-205 (1)    Ensembl 571
ncRNA sorbs1-008 619
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sorbs1-008 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061434 (1),  Ensembl_Trans:ENSDART00000158370 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB855059 (1) 518 bp
GenBank:EB855061 (1) 505 bp
CITATIONS (3)