ZFIN ID: ZDB-TSCRIPT-110912-822
Transcript Name: sorbs1-202
Previous Names: sorbs1-001, dkey-103j14.2-001, ottdart00000052066

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052066 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052066|OTTDARG00000029663|ZDB-GENE-090313-168 sorbs1|OTTDARP00000047828 DKEY-103J14.2-001 LG_none BX546482.15,CR356222.25 Danio rerio protein_coding NOVEL, 6034 bp
CCAAGTTAAGCTCAGCTGAAGTTGAAGGTCGGTTCAGGGC
TCTCCAGCAGAGGGCACAGGGAAATTTGATGCAGCTCCTG
CACGTCCACCCTGTAGGCGCACTGTATCTGCTGTGCGAGT
AACACCGTTGAGGATCATGAAGAGTTCTCCTGACCTCATG
CCTACTGAGCTGGACCCGACCCGTGTTTGCAAGGGCAAGG
GTGCAGTTACTTTGAGGGCCACGTTAGTGCACATCGATGA
TGAGGACGGCACAAGCCAAGAGCCATCCGTCAGCCCTGCC
AAAGGTGGATGGATTGGTACGGTCAATGGAGATGCCACAG
AAACAAGTCTGGCTGAGAGAAGTGTAAACAACACCAGAGC
TGATTTAAATTCAACTCAAGTCAATGAGACACCGACTAAG
GATTCTGCTGTAAGTGAGAGTCAGTTTCAGCTCACGTCCT
GCCTTGATCAGCCGAGTGCTTTTAACTCATCAGCCAAAGT
GTCCTCTTCATTCCCTCCGACCAGCAGCGTCAACCCTACA
ATCGTCCTGCTGCAGCACAACAGAGAAGCTGTGGCAGAGC
AGGGCAGTGGCCTGTATCAAGGTCCTGCCATCATCCAGAA
CAGACCTTCATCTGAGACTCCAGCAGACATGGAGGGAAAA
ACAATGAGCCTGTCTGAACGTCCAGCCGTCCAGCCACCCA
GAGTCCCAGTACGGAACACTGAGCTCTCGAAGGACTGGTA
CAGAAACATGTTCAAACAGATTCACAAAGTCCCAGAGCCT
GTTGAAGAAAATCCATATCGTCCCACCTACATATTCCCAG
AGACCAATGACAGGCCCCTGAGAAGCAGAGATGATAGACC
TTCATATGGTGGTGAGGATGTTCGGACAGTTCCTCGCTCC
AGGAGTGCTGTGGACATGGGGAGCTCCAGAGGACAGCAGC
CTGTGCCAACACGAACATCTTCACTCAAACCTCAGAGGAG
TGAGTGGGAGCCCCCTGACAAGAAAGTGGACACCAGGAAG
TACCGCGCTGAACCCAGGAGCATATTTGACTACGAGCCAG
GAAAGTCTTCAGTGCTGAGGCTGGACAGACCGGACATTAG
TCCAGAAGATGTAGATTTAGAGAATGAGCCTTGGTATAGA
TTCTTTTCTGAGATGGATTTTGGCAAAGCGAGTGCCCCCT
CTTTCAGCCCCCTGGAAACATCCTCCGACCTACAGCAATA
CTCATCCTGTAAAGTGAGTGACGGTGAAGCAGAGAAGAAG
GACGGCTCGTCCGGCAGCGGGTCGGCAGCTCCAGAATGTG
AACGACACATTTACAAGAGCGTCCTGGAGGGCGGCGACAT
CCCACTGCAGGGCCTGAGAGCGCTAAACAAACGCCACCCC
AGCACTTCTTCCAAAGACTCAGACTCTTCACATCCATTAA
GCCAAGGAGATCATGGAGAAAGCACAGATGAGGCTGTCCG
GAAACGCCACGGAGATAAAGAGAAAATTCTGGAAGAGCAG
AGACGGCTGAAGCGAGAGCAGGAAGAGGCAGATACAGCTG
CTCGGAGACACGCTGGGCTGGTTGTGACTCATCAACAGTT
CATTACTAATGACCGTTTTGGCGACCTGCTGGTTATTAAT
GAGAAGGAGAAGAGAAAAACCATAGAGAGGACTCCTGCTC
TGGCACGATTTGACTTCAGAGCAGAAAGTTTAAAGGAACT
TCCATTTCAGAAGGGAGATATAGTATACATCTATCGGCAG
GTCGATCAGAACTGGTTTGAAGGAGAGCATCATGGGAGAG
TTGGGATTTTTCCACGGAGTTATGTTGAGCTGGTGCCCCC
AACAGAAAAAGCTCAGCCCAAAAAGTGTGCTCCGGTCCAG
GTGTTGGAATATGGAGAGGCTCTTGCTCGTTTCAATTTCA
CCGGCGACACTGCTGTTGAAATGTCTTTTAGAAAGGGGGA
GCGTATAACACTAATTCGCAGAGTAGATGAGAACTGGTAT
GAAGGCAAGATTTCTGGCACAAACCGGCAGGGTATCTTTC
CAGTCACCTACATAGAGGTGCACAAGAGGCCCCGAGTGAA
AAACGGAGTGGACTATCCTGATGCCCCTATAAGCTATTCA
CCTCATCGCAGCACTAACGCTTCTCCACAGCCATTAAGAA
ATGATGTAGAATATTATGGGAGATCTTCAAGAAGTCCTGT
CATGCTGTTTGACATCCAAGACAACAACATGAATGCCAAC
TCATTCACGCAACCCCTGTCCCAGAGCAGCAGTCCTGAGC
CTGGACGCATGAGCTGTGGGATATTTCAGGCTCTGTACAA
TTACGTGCCTCAGAATGATGATGAGCTGGAGCTGCAGGAA
GGAGACCTGGTCAACGTCATGGAGAAATGTGATGATGGCT
GGTTTGTGGGTACATCAAAGAGGACGAAACAGTTTGGCAC
TTTTCCAGGAAATTATGTGAAAGCTGTTAATTTGTGACAT
ACTGTAATACAAATGAAGAATTGACGGTTTGTATGAAGCG
ATTCTAGTGCTATGCTTGAGCAGCCTGATCTGTTTGGGAC
ACTCTTACCTGTTGACCTCAAATGAAGACTTTCCTCCTGT
CCAAAATTTGGTCTGTCCCATATGAATGTCCAGGTATGTG
ATCAGTAAGGTGTGCGGCATGTCAGCGAAGAACATGCAGT
TCAACTGAACTCCAGTGGCAGCATTTGTTGAATCACTGAA
GGATTTCACGGAAGAATGAAGGTTTTTACCAGTTTTCTGT
ATTGTATTTTTGTTTTTCTTGAAGAAACTTAGCTAAAAGC
CATCAATATTAAATATCTGGGAAAAGGTGTTTAAGTTTAC
AACTGCAAATTTGACTGAAGTACAGCTCAAAACACTTCAT
CACATACCTGACATTACTGAAAAATATTAACATTTACAGT
TTATTTTTGCTATAAATGTGTGACTGTAGGAGATGACAGG
GCATCGAAGGTGTTTGTATTAAGGTTACAGGTCAGAGAAG
CAGTGAGAAAATCATACTTGTTTGTCATTTAAAAAGAAAA
TCATAATGCAATTTACACTCCTGTTGCATATAAAATTACT
GGTATATGGAGCACTCTTACAAAGAGTGGAATTACAGTTT
CTTTTCCAGTGAGGGCTCAAAGTATGAGACACAATTTAAT
ATTTGCAGATCCAAGCAAAGCCATTCATAGACATCAAAAT
GATGTAAATCAGTGTTAATGCAAGGAGGAAAACTTCACAG
CACTTACTGTACAGTACTCTCAGATTTTGCAACATTTTGG
TAACACTTCACAATAAGGTGTCTTTTGGTAACATTTGTTA
ACTATGAGCAATATTTTTATGGCGTTTATTATATGTTGTT
ATATAGTTATGTTAATTCAATTACATAATTTATGTGCATT
AATGTTACCTGATAAAGTGGCAGTCAATGTAAAAATGAAC
ATTAAAGGTAATAATCTCTGTAGAAGCTTTTATTTTTACC
TTTATCATCAGTTCATGATTGTAAACCTTTTGTAAAGTGT
TACCAAAATTTGTGAACAACTCTAGATCTGACAAACTTTG
TGATTTGTAAAAACAAATGAAACAATATAGCGTTACTGTA
TATGATGTAGTGAGGTGAAGGGCTACAACTAAACTCCACT
AAACAGATCTGACCTTAGATGCTTAGCCTCAAAAACATAC
TATTTATTTGCCTGAGTGGTGCATATTTTTATCTTTCAGT
CCTCCAATTTAAAGTGGGGTGTTTGAACGATGTATTATGA
ATCTGAGGCGCAGTATTTACCTCCGTTAGCACTAGCATTA
GCATAACATCCTAACCCAGGTACTGTTTGACAGTAACATT
TATGTAGTGTTTTGACAGGTATTGTAGTTGTGTGTTGGGA
TTCGATGATCTGTAAGATTGCTGTACCTCATTTTCAAAGT
GCCATTCACAGTATAGGATGCTACACTTGGACCTATTGTG
TTCATTTCATTTGATATTCTCCATTGATTAGCTTGTGGTC
TTCCTTAACTGAATGTAGTTTGATAGTAGATTTATTTCTG
CTTCCGTTTAAGAAGTTTTGGATTTCTTCTGATAAAAATT
GTGGAGAGTGGATTTCTTCTGATGAAAAGTTGTTTTTGAA
TCTCCCCTTAGGTTTTATACGGTCCATTCCATGTAATGCC
AGAGAACGTGCTGCTAGAGAGTTTCTGTGACTCTAAAGGG
ATAATTCACTTTAAAATTGAACATTTACTCAACTTCAAAC
CTTTATGAGTTTCATTTTTACATACTAGGATATTTAAAAG
TACCTTTATACAGTAGCTGGTAGCCACTGGTAGACCAAAA
AAAATGCTATGGAAGTCAATCACTATTTATGTTCACAGAG
GACATAAGAGGGTGAGTAAATGATTGTTTTTGGGTGAACT
ATCCGCTTTAGGCCCATTCATAACAAGGATGATATCTAGC
CTATACCAGTTATAAAAACAGCCTAAATTCAGTTGTCATA
GAGCTCATAGAGTTGACAAGACAGCTGTAATAATAAAGAG
GAATGATATTGTTGGAATCACTTTCACAGTAATATTTTTC
ATAGCTGGTGAATGATAAAACCATTGACAACCAATCAGAA
TCTGTGCTACTCTAAAAAGCTTGAGCATTTAAAGTCTCCC
CAGCAGGCACAGGACGCCAACGTAACGTCAGATTGATTGG
AAATGTAAATCAGGTTGACATCAGAACCCAATGTCAGGCT
GACATCAATGTCCAATGTCATAGAGAATGTCCAACGTCAT
GACATAGAGATTGCATTTTGGTTACTTTAAAAACACAACC
TAAAAACAACAAAGTATCAACGTCTAAGGATGTTACAGCT
TGACGTTGTGTGGACATTACCAATATGGCATCTTTCAGAT
GTTAGATTTTGGTTTCTATACCTGACAAATAAATGTCAGT
ATTTGACGTCAATGTGCCTTTGGTTTAGGATGTTGGCTTG
ATGTTGGATTTAGGTCACTTTCCGACACTACCTAAAATCA
ACAAAACATCATTGTCATTTCAAGTCGTTATTGGACGTCA
AAAAAACATTGTCCTTAGACGTTGACCTAAATCTAACCTA
AATCTAACCTAAGACTAACGTCTTATGACGTTGTGTGTTT
GCTGGGACAGATGACAAAACAGCAGTGCATGGTTTAAATA
AAAAGAAAGCATTATCCTACATTGGTGTCAGTGCTAATAA
AGTTATCATTTTTGCCATGAACGGGCTTTTGTGCTTACCA
GCCTTCCGTCCATCTCAAAACGAGAATCAGGAAGAGATCA
TTTGGACAGAAATGAAGTATTTAGATTATATATTTTTCAT
TTTGTAAACCAGTGGTTGTTGCTAAAACCTTTATCAAGAT
GTAATCACATAGAAAAACAACGAGGAATTTAAAAAAATCA
GATGTGAATTTGAACTTGAAACTATGTGTTGGTTATAATA
TAGCGTAGCATATTTGAATGTAGTGCTCTGAGACTCTTTT
AACATGGATGTGAACAAAGTTGAAATTCACAGTTCTCCTA
TTCTGTCAGAGTTGTAAATATGTAAAGTATAAATGAATGA
AAGTGACCGAAGTTACAGCAACCTCTATAAATATTACAGT
TTATATTAAATGAAGAATATTAGGAAAGCACAGAGATTTG
CGTAACACACACAGACCGTCTCATATGACTGAGCGAGTGA
TTCTGACACTGTGTTGGGATTGAAATGCCTTTCTGTCTCA
TGGCTTCGTTGAACTGTGCCTAGTTTTATTATTTTGTTTT
ATTTTATTTTTTTCTGCCTCCTGGTGAATATGTCACTTTG
TATGGAAATTTGACCCAAGTGTGTTAAAGGAGACTATTAC
AGAGTTCTTCACCACAATCATATGAGTTATTCAAGAGTGT
GAGATGACACCTGAGATGTTTAATTATGTGTAATTATTAC
TTTGTGGTCTGTATGCAGAGCGAATTTTGCATCTTTTTGT
TTTGTTTTTGTTTATTTGCAGTGCTGTTACAATTACAATG
AATTTAAACACTATTACTGCTGTGATTGCCTCATTATGCA
ATATTTAATAAACAATATTACAGCTTTTGACTGA

sorbs1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sorbs1-202 6034
sorbs1-203 (1)    Ensembl 579
sorbs1-204 (1)    Ensembl 582
sorbs1-205 (1)    Ensembl 571
ncRNA sorbs1-008 (1)    Ensembl 619
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sorbs1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000052066 (1),  Ensembl_Trans:ENSDART00000162359 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK019203 (1) 829 bp
GenBank:CO931566 (1) 760 bp
GenBank:EB991980 (1) 663 bp
GenBank:CT673557 (1) 635 bp
GenBank:EB897252 (1) 618 bp
GenBank:EB883718 (1) 600 bp
GenBank:EB893169 (1) 583 bp
GenBank:EB890021 (1) 564 bp
GenBank:EB884419 (1) 547 bp
GenBank:EB884718 (1) 539 bp
GenBank:EB886808 (1) 473 bp
GenBank:EB899911 (1) 469 bp
GenBank:EB881751 (1) 428 bp
GenBank:BM279776 (1) 368 bp
GenBank:AI106034 (1) 264 bp
CITATIONS (2)