Transcript

rpn2-206

ID
ZDB-TSCRIPT-141209-2029
Name
rpn2-206
Previous Names
  • rpn2-005
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060922 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060922|OTTDARG00000035340|ZDB-GENE-030131-7928 rpn2|OTTDARP00000047079 rpn2-005 LG_none FP245473.4,CU914784.11,CU929092.7 Danio rerio protein_coding KNOWN, 537 bp
CGATCACACAACCGTTTATATCATTACAAACCAACATCTG
AAATAGGTTTCATCCGCGTGACCCGGAAGTTCTCTCAGCT
GGGTGACGCTGCATTAGGCGACATGGCTAATCTCTGTGTG
TTCAGCGTGTTGGTCCTGTCCTTGGTTATTGAGACCCAGA
CTCTAACCCCATCCCATCATCTGACCACCACTGATGTGGC
CAGACTGCAGGCTGTATTGAGCCAGCCCCTCACTGATCTC
AAGTCTGCCTATTACTCTGTTGTTGGACTTAGGAAGCTGG
GGATCTTTGTTGCAGATGCAGATGAGACATGCAGATTTAT
CAAGTCAAACCTTGACCCCTCTAGTGTCGAGTCACTGTTT
TATGCAGCAGAATCTAGCCAAGCTCTTACTGGATGTGAGA
TTCTTGTGTCAAATGACACGCGTGATTTGTTGTTGGCCAC
AGTGAGTGAGGACTCCACTGTCTCTCAGATCCATCACTCT
GTGAGTGCTCTCAGCTCTCTTGGATTACCTCTGGCCTCAC
AGGAAGTAGTCAGTGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations