Transcript

slitrk2-201

ID
ZDB-TSCRIPT-141209-1979
Name
slitrk2-201
Previous Names
  • slitrk2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060750 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060750|OTTDARG00000042116|ZDB-GENE-080327-7 slitrk2|OTTDARP00000046951 slitrk2-001 LG_ CR762422.23 Danio rerio protein_coding KNOWN, 3032 bp
ATGCTGAACAACATTCTCTTGCTGAGCGTTTTAACAGTGA
CCAGTTTCCCTTCAAAGACAGACAGCCGCAAAACTTCCAA
AGACATTTGCAAGAACCGGTGCTCCTGCGAGGAAAAGGAG
AACGCGCTGAATATCAATTGTGAAAACAAGGCTTTTACCA
CGGTCAGCCTGTTCCAGCCTCCGCAAAACAAAATCAGTCA
GCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
AACGAATTCCTCAATTATGGTAATGTAACATCTCTTCATT
TGGGTAATAATGGCTTGCAGGAGATCAAAACTGGGGCATT
TAATGGGTTAAAAAACTTGAAGCGTCTTCATCTCAATAAT
AATAACCTGGAAATCATAAGAGAGGACACTTTTTCTGGCT
TGGAGAGTTTGGAGTATCTGCAAGCTGATTATAATTACAT
TAGTGCTATAGAGGCAGGGGCTTTTAACAAACTGAATAAA
CTCAAAGTCCTGATCCTTAACGACAACCTTTTGCTCTCTC
TACCTAACAATATATTCCGCTTTGTCATGTTGACGCATTT
GGATTTAAGGGGAAACCGGCTGAAGACGCTACCGTTTGCT
GGCGTTCTTGAGCATATAGGTGGAATAATGGAGATTCAGC
TGGAAGAGAACCCATGGAATTGCACTTGTGATTTGATACC
CCTGAAAGCCTGGCTGGATACTATTTCGGTCTACGTGGGG
GATATTGTTTGCGAGACACCATTCAGGCTGCACGGTAAAG
ATGTCACACAGCTGATCAAGCAAGACCTTTGCCCCAGGCG
CAATCCTGGAGATGCAAGTCATCGTGCGATGCAACCACCA
TCTGATTCCCAATACCAGGGTCTGTCTCCAACTCTGCGGC
CTCGAGTCACGCCGACAAGAGCCCCCAAGGCCTCCCGCCC
CCCCAAAATGAGATACCGCCCCACTCCTCGTGTCACGTCT
AGCAGAGATAAACACGTATTCGGGCCTATCATGGTGTATC
AGACGCGCTCGCCAGTCCCAATGACCTGTCCGGGCATTTG
CGTGTGCACGTCTCAAAATCCAGACAGCGGATTAAACATC
AATTGCCAGGAACGGAAACTTCAGAACATCTCTGAACTTC
AGCCCAAACCGTCGTATCCAAAGAAGCTGCATTTGACTGG
TAACTATTTGCAGATCATATATAGAACAGATCTGACAGAG
TATAGCTCTCTTGAGCTCCTTCACTTAGGGAATAACAGAA
TAGCAATCATTCAGGACGGAGCCTTTGAGAATCTTACCAG
TTTACGGAGGCTTTATCTGAATGGAAACTACATCGAAAGC
CTGTCCCAGTCTCTGTTCGCTGGGCTGCAGAGCTTGCAAT
ATCTCTACCTGGAATACAACATCATTAAAGAGATTTTACC
CCACACCTTTAACTCGCTGCACAATCTGCAGCTATTATTT
CTTAATAATAACCTGCTGAGATCCCTTCCCGACAATGTGT
TTGGAGGTACCATGCTGACAAGGCTTAATCTCCGAAATAA
TCATTTTTCCCATCTCCCCGTGCGTGGGGTGCTGGACCAA
CTCTCTGCCTTCATTCAGATCGACCTCCAGGAGAACCCAT
GGGACTGCACCTGCAACATTGTGGAGCTTAAGAACTGGAT
GGAGCTTTCCAGCACCAGCGTTGTGGTGAACGAGATCACA
TGCGACTCACCCTCCAAGCATGCAGGTCGCCTCTTGCGCT
CCCTCCGAAATGATGCCATATGCCCAGAGACTGATGAGGT
TTCAGTGACTAAACCCCCGACTGTTGTGAGCTCGAGCACT
GAAGCGACCCCTCCTTCTTCCGTAACCCCGACGGACAGGA
TGCCCGAGATGCCTCCAGAGGTGCCCTTGTCGGTTCTCAT
CTTAGGCCTGCTCGTTGTGTTCATTCTGTCAGTGTGCTTT
GGGGCAGGATTGTTCGTTTTCGTCCTCAAACGTCGCAAGG
GGGTGGAGAACGTTCCCTCAGGCACTAATAATCACTTGGA
CTTGAACTCTTTCCAAGTACAATATGGCTCGTACAACGCA
GATGTCAATGCGGATAAAAGTGACAACCACGTGTACAACT
ACATCCCCCCTCCCGTGGGCCAGATGTGTCAAAACCCTAT
CTACATGCAAAAGGAGAGCGAGCAGGTGGCCTATTATCGA
AACCTGAAGGAGCTGAGCTTCAACACCCTCGATCCTAAAA
AGGAGGAGCTTGACCGAAGCCCAACTTTCACCATAAGCAC
AGTGGAGTTCATTGATAAGCAACCCTGTGCCAATCGTGAA
CCAGAGCTGCTTTATCAGAACATTGTAGAGAGAGCGAAAG
ATCTACCCCAATCTGGGCCGCTCAGCTATAATTTTTGCAC
TTTACCCAAAAAATCCTTCATCCCTCCCTACGAAACCTCC
AGGCGACTCAACCAGGATCGATTAAACAAAACCGTTCTCT
ACGGGACCCCCAGAAAATATGCTGCACAGTCCAAAAACGA
GCATCCTTTGCTATCCAACAAGCTTAAAACCGAGCCGGAC
TACCTCGAAGTGCTGGAGAAACAAACTGCGATGAGTCAGT
TGTAAGATCGAGTCCTTGTAAACCTGTACCATCTGTGTAT
TCCACCACAAGAGACAATAATAACAACAACACCATCACAG
ACCTAAGCCTTCCATCTTCTTTTAGAGGCTGTATACATAC
CCGCGATTTAAAGATGATATATTATTTTCTCTAAGAGTTA
AATTATTTCTTCTACTTGAAACAGAAAGACTGTAGCAGTT
GTCGCAAGAATATGTATAGCTTACAGCTCCATGCTTTTTT
GTAATATGAAATATATTTTCTCTCAGATGACAGGGTTGTT
GAAATGACATTCCTGTAGAACATGTTGGATGGTGAGTGCA
ACACAAATTCCTGGTTCCAGAAGTGCCTTTGCACTTGAAG
AATTTTATCTCTGCTTTCTGCTAATCAAATTTTTATAAGT
GCTGTATTTTAAGACTCTTTATGTAAAATAGAATTATTTG
TCCATTGCATTAAACGGAAAAGTAAAAAGGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations