header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1979
Transcript Name: slitrk2-201
Previous Name: slitrk2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060750 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060750|OTTDARG00000042116|ZDB-GENE-080327-7 slitrk2|OTTDARP00000046951 slitrk2-001 LG_ CR762422.23 Danio rerio protein_coding KNOWN, 3032 bp
ATGCTGAACAACATTCTCTTGCTGAGCGTTTTAACAGTGA
CCAGTTTCCCTTCAAAGACAGACAGCCGCAAAACTTCCAA
AGACATTTGCAAGAACCGGTGCTCCTGCGAGGAAAAGGAG
AACGCGCTGAATATCAATTGTGAAAACAAGGCTTTTACCA
CGGTCAGCCTGTTCCAGCCTCCGCAAAACAAAATCAGTCA
GCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
AACGAATTCCTCAATTATGGTAATGTAACATCTCTTCATT
TGGGTAATAATGGCTTGCAGGAGATCAAAACTGGGGCATT
TAATGGGTTAAAAAACTTGAAGCGTCTTCATCTCAATAAT
AATAACCTGGAAATCATAAGAGAGGACACTTTTTCTGGCT
TGGAGAGTTTGGAGTATCTGCAAGCTGATTATAATTACAT
TAGTGCTATAGAGGCAGGGGCTTTTAACAAACTGAATAAA
CTCAAAGTCCTGATCCTTAACGACAACCTTTTGCTCTCTC
TACCTAACAATATATTCCGCTTTGTCATGTTGACGCATTT
GGATTTAAGGGGAAACCGGCTGAAGACGCTACCGTTTGCT
GGCGTTCTTGAGCATATAGGTGGAATAATGGAGATTCAGC
TGGAAGAGAACCCATGGAATTGCACTTGTGATTTGATACC
CCTGAAAGCCTGGCTGGATACTATTTCGGTCTACGTGGGG
GATATTGTTTGCGAGACACCATTCAGGCTGCACGGTAAAG
ATGTCACACAGCTGATCAAGCAAGACCTTTGCCCCAGGCG
CAATCCTGGAGATGCAAGTCATCGTGCGATGCAACCACCA
TCTGATTCCCAATACCAGGGTCTGTCTCCAACTCTGCGGC
CTCGAGTCACGCCGACAAGAGCCCCCAAGGCCTCCCGCCC
CCCCAAAATGAGATACCGCCCCACTCCTCGTGTCACGTCT
AGCAGAGATAAACACGTATTCGGGCCTATCATGGTGTATC
AGACGCGCTCGCCAGTCCCAATGACCTGTCCGGGCATTTG
CGTGTGCACGTCTCAAAATCCAGACAGCGGATTAAACATC
AATTGCCAGGAACGGAAACTTCAGAACATCTCTGAACTTC
AGCCCAAACCGTCGTATCCAAAGAAGCTGCATTTGACTGG
TAACTATTTGCAGATCATATATAGAACAGATCTGACAGAG
TATAGCTCTCTTGAGCTCCTTCACTTAGGGAATAACAGAA
TAGCAATCATTCAGGACGGAGCCTTTGAGAATCTTACCAG
TTTACGGAGGCTTTATCTGAATGGAAACTACATCGAAAGC
CTGTCCCAGTCTCTGTTCGCTGGGCTGCAGAGCTTGCAAT
ATCTCTACCTGGAATACAACATCATTAAAGAGATTTTACC
CCACACCTTTAACTCGCTGCACAATCTGCAGCTATTATTT
CTTAATAATAACCTGCTGAGATCCCTTCCCGACAATGTGT
TTGGAGGTACCATGCTGACAAGGCTTAATCTCCGAAATAA
TCATTTTTCCCATCTCCCCGTGCGTGGGGTGCTGGACCAA
CTCTCTGCCTTCATTCAGATCGACCTCCAGGAGAACCCAT
GGGACTGCACCTGCAACATTGTGGAGCTTAAGAACTGGAT
GGAGCTTTCCAGCACCAGCGTTGTGGTGAACGAGATCACA
TGCGACTCACCCTCCAAGCATGCAGGTCGCCTCTTGCGCT
CCCTCCGAAATGATGCCATATGCCCAGAGACTGATGAGGT
TTCAGTGACTAAACCCCCGACTGTTGTGAGCTCGAGCACT
GAAGCGACCCCTCCTTCTTCCGTAACCCCGACGGACAGGA
TGCCCGAGATGCCTCCAGAGGTGCCCTTGTCGGTTCTCAT
CTTAGGCCTGCTCGTTGTGTTCATTCTGTCAGTGTGCTTT
GGGGCAGGATTGTTCGTTTTCGTCCTCAAACGTCGCAAGG
GGGTGGAGAACGTTCCCTCAGGCACTAATAATCACTTGGA
CTTGAACTCTTTCCAAGTACAATATGGCTCGTACAACGCA
GATGTCAATGCGGATAAAAGTGACAACCACGTGTACAACT
ACATCCCCCCTCCCGTGGGCCAGATGTGTCAAAACCCTAT
CTACATGCAAAAGGAGAGCGAGCAGGTGGCCTATTATCGA
AACCTGAAGGAGCTGAGCTTCAACACCCTCGATCCTAAAA
AGGAGGAGCTTGACCGAAGCCCAACTTTCACCATAAGCAC
AGTGGAGTTCATTGATAAGCAACCCTGTGCCAATCGTGAA
CCAGAGCTGCTTTATCAGAACATTGTAGAGAGAGCGAAAG
ATCTACCCCAATCTGGGCCGCTCAGCTATAATTTTTGCAC
TTTACCCAAAAAATCCTTCATCCCTCCCTACGAAACCTCC
AGGCGACTCAACCAGGATCGATTAAACAAAACCGTTCTCT
ACGGGACCCCCAGAAAATATGCTGCACAGTCCAAAAACGA
GCATCCTTTGCTATCCAACAAGCTTAAAACCGAGCCGGAC
TACCTCGAAGTGCTGGAGAAACAAACTGCGATGAGTCAGT
TGTAAGATCGAGTCCTTGTAAACCTGTACCATCTGTGTAT
TCCACCACAAGAGACAATAATAACAACAACACCATCACAG
ACCTAAGCCTTCCATCTTCTTTTAGAGGCTGTATACATAC
CCGCGATTTAAAGATGATATATTATTTTCTCTAAGAGTTA
AATTATTTCTTCTACTTGAAACAGAAAGACTGTAGCAGTT
GTCGCAAGAATATGTATAGCTTACAGCTCCATGCTTTTTT
GTAATATGAAATATATTTTCTCTCAGATGACAGGGTTGTT
GAAATGACATTCCTGTAGAACATGTTGGATGGTGAGTGCA
ACACAAATTCCTGGTTCCAGAAGTGCCTTTGCACTTGAAG
AATTTTATCTCTGCTTTCTGCTAATCAAATTTTTATAAGT
GCTGTATTTTAAGACTCTTTATGTAAAATAGAATTATTTG
TCCATTGCATTAAACGGAAAAGTAAAAAGGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slitrk2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000060750 (1),  Ensembl_Trans:ENSDART00000005738 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU468746 (1) 1866 bp
GenBank:AW233600 (1) 454 bp
CITATIONS (2)