Transcript

nfkb1-202

ID
ZDB-TSCRIPT-141209-1890
Name
nfkb1-202
Previous Names
  • nfkb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000060446 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060446|OTTDARG00000041932|ZDB-GENE-121204-3 nfkb1|OTTDARP00000046713 nfkb1-001 LG_none CU633618.8,CU929193.13 Danio rerio protein_coding KNOWN, 1071 bp
GAATTTCCAGTAAGGAAGTCAAGCTGTCTATTCAAACCTC
GCGTTGATCTCGACATGATTTACTGCGATCTTTCGCGACA
GGCGATTAAAACGCATTAATGCATTAAATGCTGGAGCTCC
TCCGTCTCTCTCGCCACCCGCCGACATTAGCGATCCAACA
TGGAGGAATAAGTTGAAAAGTCAGCCTCAGATCCGTGTGT
TTGGCGCTGGGCAGCAAAGGAATCATGGCTGGCGAGGACC
CATACGTCACGTATTTGGACAGCAATGACCCGTTTCAAGA
CACCATATGGATGAACACCATGGACCCCACAACCTTTCCA
GCCATCCACAACAATAACATCATGAGAACAGCAGTTGATG
GGCCTTGCTTACAAATCACAGAACAACCAAAACAGAGGGG
CTTCAGGTTCCGCTATGGGTGTGAGGGCCCGTCTCACGGA
GGGCTTCCAGGGGCCTCCAGCGAGAAGAACCGCAAGTCCT
ACCCACAAGTGCAGATCTGTAATTATCAGGGCCCTGCTCG
TGTGGTGGTCCAGCTGGTGACCAACTCTCAGCATCCGCAT
CTTCACGCTCACAGTCTGGTGGGAAAACAGTGTGATAAAG
GCATCTGCATCTCCGACATGCAGCCCAAAGACTCCAGCAT
CAGTTTCCCTAATTTGGGCATCCTGCACGTGACCAAGAAG
AACGTGAGTAAAGTGTTGGAGGAGCGCATGATGGAGGCCT
ACAGGATGGGTTACAATTACGGCATCTTCATCCACCCGGA
AATCGACGCCTTGCAGGGAGAAGTGCGCATGCCCAGAGAA
CTCAACGAGGCTGAGAGGAGTCTGATCAGCAGTGCAGCGT
CTCAGCAGGCGAAGGAGATGGACCTCAGTGTGGTTCGGCT
GATGTTCACTGCGTTCCTGCCTGACAGTGATGGAGGATTC
TCACGCAGACTGGAGCCCGTCATCTCAGAGCCCATATATG
ACAGCAAAGCTCCAAACGCCTCCAATCTGAAGATCGTGCG
GATGGACAGAACCGCCGGCTGCGTGACCGGAGGAGAAGAG
GTTTATCTGCTCTGCGACAAAGTCCAGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations