ZFIN ID: ZDB-TSCRIPT-141209-1852
Transcript Name: cda-002
Previous Name: dkey-33m11.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060291 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060291|OTTDARG00000022430|ZDB-GENE-040426-1911 cda|no_translation cda-002 LG_ CR558302.9 Danio rerio protein_coding KNOWN, 426 bp
GCTGAGCCGCAGAACGACTACACACACACTACATAGCAAC
ATGGAAGACCAAAAGATGATGCATGAGCTTATTAATGGGT
TGAATGGGCACTTGTTGGGAATAAAAGAGTTGACTCGAAA
ATCTCAAGAGGCTAAGAAGTTTGCCTATTGCCCATACAGC
AAGTTTCGAGTCGGGGCAGCACTGCTGACACATGACGGGA
CGGTTTTCACAGGGTGTAACGTGGAAAACGCATGCTTCAA
CCTGGGAATCTGTGCTGAGAGAGTTGCCATTTCCAAAGCT
GTATCTGAGGGCTACAGGGATTTCAAAGCCATTGCTATTG
CGAGTGATATGTGTGAGAACTTTATTTCCCCCTGTGGAGG
ATGCCGGCAGTTCATGAGAGAGGTAAGTTCCTTTTTACAC
TGTATTCAGTGCTTCAAGGATTTTGC

cdab TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cdab-201 (1)    Ensembl 1429
ncRNA cda-002 426
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cda-002 Contained in:
[BAC] DKEY-33M11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000060291 (1),  Ensembl_Trans:ENSDART00000161630 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH506605 (1) 448 nt
GenBank:EH503377 (1) 440 nt
GenBank:EH532761 (1) 424 nt
GenBank:EH529574 (1) 416 nt
CITATIONS (2)