ZFIN ID: ZDB-TSCRIPT-141209-1821
Transcript Name: pde12-201
Previous Name: pde12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060182 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060182|OTTDARG00000041760|ZDB-GENE-060519-25 pde12|OTTDARP00000046510 pde12-001 LG_none CU638695.6,FP067440.6 Danio rerio protein_coding KNOWN, 2114 bp
ATAACACAGCCGTTTCTCGATCGCGGAAGCCGCTGGTAGT
TTCTCATTCACGAGTTCCTCATGTGGAGTCGGCTGTCATT
CTCAACTAGGTCTTTCTTTTTTCGGTTTATTCCTCCGTCT
TTAATCCCACCCCGCAGAAATCTGTTCACGGCGGGGTTTA
AGATGAGTATGGAGAGATGTGTAGTGCGGTGTGTGGAGTC
CGAGTCCAAACTGACCATATCATTCAGTCTGAACGGCAGT
AATAAACACATGCTGAGGGACAAAACTGAACCTCTGGGAA
AGCTGCTGGACAGAATAGCCAACAACAGCGTCAAGACCAC
TGCTGGCAAATCCAAAAAACACAAACCAAGCAAAGAAAAA
CCCGAGAGCCAAGAAGCAGAAAAACCAGAAACCAGTCTAA
GTGTGAACGGACAACCAGTTTCACCAGAAACTCTCAATTC
GGATGCCTGGGAAGATGGAGCAGTGCTGCAAGTGGGCGAC
CTAAAGTATAAAGTGGAGAGGAATCCTCCAACATTCACTC
AATCCGAGCTGCCGTCTTCACTAATGGCCGGATTTCCTGT
GTGTCCGAAAATAGAGATTGAATTTGGAGATCTGAAGGAC
TGCGAGTTCAGATGGTTTAAAGAAAGTTCAGCTAGTGCAT
ATATTACAGGAGATGCAGAATGCTGGAGAGAAGCTGGATC
TGAGCGTGTGTTTACGCCATCGAATTTAGACATTGGGTTA
AGGCTGATGTTGAAATGCACGCCGGGGAATGGCTCTAAAA
TTGGGGAACCCAAAAAACTGGTGTCTTCCAGCGCTGTAGA
AGCCGGTCCGGGGATTTGCACATTTGATAACAGGCACATT
TACACACAGAAGCTCACTGATGAGGGTTCATTGAGGGTTG
TGTCTTATAACATCCTAGCGGACGTTTACGCTCAAACGGA
TCTTTCTAAAACAGTGTTGTACCCTTATTGTGCGCCCTAT
GCTCTACAAATGGACTATAGGCAGAATCTGATCAAGAAGG
AGCTTTCAGGGTATAACGCTGACATTATTTGCCTTCAGGA
GGTGGATAAATGTGTGTTTGTAGACGTTTTATGTCCTGCT
TTGGATGCGTTTGGGTTAGATGGTGTTTTTAGGATTAAGG
AGAAGCAGCATGAAGGGCTGGCCACATATTTTAGGAGGTC
TAAGCTGAAGCTGGTGGAGCAGTATGATGTTATGTTGAGC
GAGGCTTTGACCACGGATCCTATACATCGGGAGCTGTGGG
AAAAAGTGTCCTGCAGTCCCAGCTTGAAGGAGAAAATTGA
AAAGAGGTCGACGACTTTGCAGGTGACCGTCTTACAGTCG
TTGTGTGACCCGTCAAGGATATTATGTGTAGGAAACACAC
ACCTGTACTGGCGCCCTGAAGGAGGAAACGTTCGTCTGGT
CCAGATAGCAGTGGCTCTGGAACACATGAAGCAGGTGGTG
ACAGAGAAGCATCCCGGCGCCAGACTCATATTTTCGGGTG
ATTTTAACAGCACTCCGTCCTCCGGCCTCTTCCAGCTGCT
CAGTCAGGGCTGCATCCCGGAGGATCATGAGGACTGGGGC
TCCGGGGGTCCAGAAGAGCAGATCCGACTAGGACTGACCA
ACCCGTTCCAGCTGTCCAGCGCATGTGGAGTCCCGGACTT
CACCAACTTCGTAGGAGGATTTCAGGGGTGTCTGGATTAT
ATTTTTGTGGAGCCGCGGACGCTGCAGGTGGAGCAGGTCA
TTCCTCTGCCCAGTCTGGAGGAGGTGAGCAACTGTGTGGC
ACTGCCAAGCATCTCGCACCCGTCTGATCACATCGCACTG
GTGTGTGACCTCAAGTGGACGACTGACAGCGATTAACCAC
AATATTAAATCAGATTTTTATTCCAGTATTGCATTTGTAT
GTGTCATATAAATTTATTCTTGCTTGTGTAATGCAATATT
ATATCACATTAAACAATTTAACAAATGCAACTACTGCACA
TATTAAAAGCTGCATTTGCCATGCTTAAATTATTAAATTC
TTTGCTGAATTTGTAACACTTTTTCTTTTAACTTTTCAAA
TGATATGGTGGTTTGCGTTTGGTCAAAGACAAGAATCAAA
ACAATAAAAGCATAAAACAGTATTACAGCTTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pde12-201 Contained in:
[BAC] CH73-104F13 (1)
[Fosmid] CH1073-165F9 (1)

Genome Resources: Vega_Trans:OTTDART00000060182 (1),  Ensembl_Trans:ENSDART00000067608 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC116522 (1) 2094 nt
GenBank:BC134883 (1) 1797 nt
CITATIONS (2)