Transcript

dbx1a-201

ID
ZDB-TSCRIPT-141209-1787
Name
dbx1a-201
Previous Names
  • dbx1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059826 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059826|OTTDARG00000041489|ZDB-GENE-000128-8 dbx1a|OTTDARP00000046446 dbx1a-001 LG_ CU929054.6 Danio rerio protein_coding NOVEL, 1484 bp
AAGGACCCTTGCAGGGGCCTAGATATAAAGGACCCCTTCC
CAAACGGAGACCTCCAGAAGCAAATCGTCATTCGGTCAGT
TCAGAGCTTGCCAGAAGAGACTTGTGTAATACTAACAGGA
GTCATTTAAGTCATCTTTTAATAGCCGGGACCATGATGAT
CCCAAGTGTTATTGCACCACCTGCTATATATTCAGCATTT
ATGCGTCCTGCTGCATCGCTGCATTCACCCTTTCCAGCTC
ACCCGAGCTTCCTGGTGGAGGACCTTCTGCGCATCAACAG
ACCCAGCGGTTTCCTGAGCCAAACCGCGCACTCTCCATGC
GCATCTCCTCCAAATTCAACGCCTCTTTCCATCCCGGATA
ACTGCAGGATTTTGGACAGAGTTAGCCCTGGCATCACGGA
AAAGCATGGACCTTGCTCCCCCAAAACGCCAGTCTCCAGC
AAGGATCCAACATATTTAAAGTTTGGAGTGAGTGCCATTT
TGGCACCGTCACCAAAGAAAGCCACATCTCCACCCTCCGT
CCACAGCATACACCCTAAAGGATTCTCTGTGCCTTATTTT
GATGGTTCATTCTGCCCTTTCGTCCGTTCTTCATACTTCC
CTGCTCCTTCATCGGTCGTGCCCATTCCTGGAACTTTTTC
CTGGCCTCTTGCTGCGAGAGGGAAGCCCAGAAGAGGGATG
CTCCGCCGGGCTGTGTTTTCAGATGTGCAGCGCAAAGCTC
TGGAGAAAATGTTCCAAAAGCAAAAATACATCAGCAAGCC
AGACCGGAAAAAACTTGCAGCCAAACTCGGACTAAAAGAT
TCACAGGTCAAAATCTGGTTCCAGAATCGGCGAATGAAAT
GGAGAAACTCCAAGGAGAGGGAGTTGCTTTCATCCGGAGG
CTGCCGGGAGCAAACCCTGCCAACCAAAACAAACCCTCAC
CCAGACCTAAGCGACGTGGGTAAAAAGTCTTCCGAGGATG
AAGATGAAGACGACGCATGCGCTCCATCGCATTTCTGTCT
CTCACCCAGACGCGTAATGTCAAACAGCACTGATTCCAGC
ATTACATTTAAACACTCGGACTTTTCTGAATCAGAGGATG
AAATAACAGTCTCATAAGCAAATTCATGAGCTGCATAATG
TCTGTATTTCAAGCACAACGTTATGTTTAACCACGTTATG
GTTCCACTGGCGTATAATTTCACTTCTATGTACAAATGAG
TGTTTGTAGCAAAATCTTTTCCACATCACTTTATATTTAC
TTATTTGAAAAACCTCGCAAAATGATTTTGCTGTGTCGCA
CAGCTTTTTGTGGGGAACTGTACAGTATTTTGTACAAATA
TTTTTGTATGGATATTTTATACCAAGAATTTTGAGTTTTA
GATTCTTTATTAAAGTTGTAGACGTATGTATAATTTATAC
GAATTTATCCCTTCGTGCCACATTGTATGCATATGTATAT
GTTGAAAATGTTTTGTATTGTTTGCAAATAAATTGTAAAT
TTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations