Transcript

zbtb24-201

ID
ZDB-TSCRIPT-141209-1698
Name
zbtb24-201
Previous Names
  • zbtb24-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000055203 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055203|OTTDARG00000038530|ZDB-GENE-081022-123 zbtb24|OTTDARP00000043300 zbtb24-001 LG_ CU469532.14 Danio rerio protein_coding NOVEL, 4805 bp
AGTTCTCGCGAGATGTGCGTGTCTGAAACGGTGCCTTTAA
GGTTCAGTGTGCGAGTAAGGTCATCATGTCTGCCCTTCCT
CCATCATCATCATCATCATCATCACCAGCAGTCCTCGCTC
TGCACTCAGCAACACACAAGGACACAATCCTGCACAAGTT
TGACACGCTCAGGAGAAGTGAACTGCTCTGCGACATTACC
CTGATCGTGGAAGATGTGCACTTCAAGGCGCACAAGGCTC
TCCTAGCAGCGAGCAGTGAATATTTCTCAGCATTGTTCAC
CGCTGAAGAACAGGTCAGCCAGTCGCTCTACAAGCTGGAC
GGCATGACGGCGAACACCTTCTCCTCCGTGCTGGAGTTCA
TGTACAGCGCAGTCGTGTTGGTGGACGAGAGCAGCTCTGA
GCAGCTGATGGAAATGGCCAGATTTCTGGTCATCCCAGAT
CTGATCAAAGCCCATGAGGACCTGCAAGCTGTTGATGAAC
ACATGCAGGTGAAGCGGAAAAGAGGGCGTCCTAAAAAGAA
CCAGGATTTAAGCCAAAAAGAAAATCCAGAAAGTGAATTA
CAGGCACAATCCAGCTCGGAGATTCAGGAAGTCAATGAGG
AGCCTGCATCTCCTGCAACAGATGGGAGTGATGGAGAGTT
TAACCCCAGAGAGGAGAGAAGACGAGAGGGAAAACGCAAA
ATCAAACAGCCAATCAGACTGAAGGGCTTCAGAATGGATG
ATCTAATGGAGGGGAAGGAGCCGGGGAAAAGAGGACGCAG
GAGGAAATATCCAGACACAGAGGCCAGATGTGAGGAGTGT
GGAAAAGTCTTTAAAAGCCACCTGTTCTTGAAGATACATC
AGCGAACACATACAGGTGAGAAGCCGTTCAGATGCAGTGT
GTGTGGGAAGGAGTTCACGCAGAAACACACTCTTCTGGTT
CATCAGCGGATGCACACTGGAGAAAAGCCCTACATCTGCA
CCGTATGCTCTAAAGCCCTGTCCACCAAACACTCTCTGCT
GGAGCACATGAACCTGCACACAGAGAATAAATTGTTCACC
TGTGAGGAGTGTGGGAAGAGCTTCAGTCAGCAGCGGCAGC
TAAAGAGCCATAACCGCGTCCACACTGGAAAAGGCTTGCC
TGAATGTGCTGAGTGTCATCATAAATTTATGGATGCGGCT
CAACTGAAGAAGCACCTGAGAACTCATACTGGTGAGAAGC
CGTTTACATGCGAGATCTGCGGAAAGTGTTTCACCGCCAA
GAGCACATTACAGACACACATCAGGATACACAGAGGAGAG
AAGCCATACGTCTGCAAAGTCTGCGATAAGACCTTCTCTG
ACCCCAGTGCCCGACGGCGTCACGAGGTGTCTCACACAGG
CAAAAAAACATTCTCCTGTTCGATCTGCAAGGTTTCATTC
GCCCGGAAGGACAACCTCAAAGCTCACATCAAAACTCACA
ACAAAGAGAATCCACCGGCACAAGCAGAAAGCACAGATAA
ACCCCCACACTCAGCACCAGAACAACAACAACAACAACAA
GAACAAGAACAACAGCAGCAGCAAACATCAGGAGATAAAG
AACTGCACAGCATCCTCCAGCTCCAACCCTTTCAGCTTCC
AGCCCATGGCGAGCAGGAGATCCAGCTGCTGGTGACCGGA
GAAAACCTCAGCCTGGACCAGGAGCAGAGCATCAGCATCA
TCACATCTGAAGACACAGAGCAGAGCCTCGCACTTCTCAC
ACAGCCGTCCGGACACGTTCAAAACCTGGCCGTGGTCACT
CCAGATGGAAACGCCCAAATCCAGACCATCAGCGTTTTGG
GTGGTGAAGTGAACGGCGGAGATCCAGAGCAGATGCATGT
GATCACGCTGAGCAAAGAGGCTATGGAGCAGCTGCAGGTT
CATCACGGAGCTCCGCAGCAGCTGCAGGTCATTCATCAGC
TTTCTGAAGAGCAGACGGGGCCCGTGGCGGGCATTCATAT
CAGTGGACAGAGCGGACAGGCCATTTCTATTAGCCAGACC
ACTGAGCAGATCCCTAGTGATCAGATCCAGGGACAGACCT
TCCAGATACAAGCTGGAACAGTCTCGTATCTGTACACCAC
CAGCATGAACCCGCAGAACTGAACATGCATGTGTGTTCGC
CTCTAATGTTTGAGTTTCTTTCTTCTGTTGAACACAATAG
GAAGATATTTTGAAGAATGTTGGATGCTGGCATCCATTGA
CTTCCATACTGTTTTTTTCCTTCTATGGAAGCTAATGGGA
CACTAGGATGAACCCGCAGAACTGAACATGCATGTGAGTT
CGCCTATAATGTTTGAGTTTCTTTCTTCTGTTAAACACAA
AAAGAAGATATTTTGAAGAATGTTGGTTGTTGGCACCCAT
TGACTTCAATTAGCTTGCAAAGAAGAAAAAAAATATTATG
GGACACCAACATGAACCTGCAGAACTGAACATGCATGCGT
GTTCTCCTAAAATGTTTGAGTTTCTTTCTTCTATTGAACA
CAAAAAGAAGATATTTTGAAAAATGTTGGATGCTGGCATC
CATTGACTTCCATAGTATTTTTTTTCTTCTATGGAAGCTA
ATGGAACGCTAGGATGAACCCGCAGAACTGAACATGCATG
CGAGTTCGCCTTTAGTGTTTGAGTTTCTTCTGTTGAACAT
AATAAGAAGATATTTCGAAAAATGTTGGTTGTTGGCACCC
GTTGACTTCCATACAATTTTTTTCCTTCTATAGAAGCTAA
TGGAACGCTCGGATGAACCCGCATAACTGAACATGCATGT
GAGTTCGCCTATAATGTTTGAGTTTCTTCTGTTGAACACA
GAAAGAAGATATTTCGAAGAATGTTGGTTGTTGGCACCCA
TTGACTTCCATAGTATATTTTTCTTTTTTGCAAGCTAATG
GGACACCAACATGAACCCGCAGAACTGAACATGCATGTGA
GTTCGCCTATAGTGTTTGAGTTTCTTTCTTCTGTTGAACA
GAATAATAAGATATTTCGAAGAATGTTGGTTGTTGCCACC
CATTGACTTCCATAGTGTTTTTTAGGACACCAGGATGAAC
CTGCAGGACTGAACATGCATGTGTGTTTGCCTAAAATGTT
TGAGTTTCTTTCTTCTGTTGAACACAGAAAGAAGATGTTT
TGAAGAATGTTGGTTGTTGGCACCCATTGACTTCAATTAG
CTTGCAAAGAAGAAAAAAAATATTATGGGACACCAACATG
AACCTGCAGAACTGAACATGCATGTGTGTTGGCCTATAAT
GTTTGAGTTTCTTCTGTTGAACACAAAAAGAAGATATTTT
GAAAAATGTTGGATGCTGGCATCCGTTGACTTCCATAGTA
TTTTTTTCTTCTATGGAAGCTAATGGAACACTAGGATGAA
CCCGCAGAACTGAACATGCATGTGTGTTGGCCTATAATGT
TTGAGTTTCTTCTGTTGAACACAGAAAGAAGATGTTTTGA
AGAATGTTGGTTGCTGGCACCCATTGACTTCTATAGTATA
TTTTTTTCTTTTTTGCAAGCTAATGGGACACCAACATGAA
CCCGCAGAAATGAACATGCATGTGAGTTCGCCTATAATGT
TTGAGTTTCTTTCTTCTGTTGAACACAAAAAGAAGATACT
TTGAAGAATGTTGGTTGTTGGCACCCATTGACTTCCATAG
TATTTTTTTTCTTCTATGGAAGCTAATGGAACACTCGGAT
TATCCCGCAGAACTGAATATGCATGTGAGTTCACCTATAA
TGTTTGAGTTTCTCTCTTCTTTTGAACACAGAAAGATGAT
GTTTTGAAGAATGTTGGTTGCTGGCACCCATTGACTTCCA
TAGTATATTTTTTTCTTTTTTGAAAGCTAATGGGACACCA
GCATGAACCCACAGAACAGAACATGCATGTGAGTTCGCCT
ATAGTGTTTGAGTTTCTTTCTTCTTTTGAACACAATAAGA
AGATATTTTGAAGAATGTTGCTTTCTGGCACCCAATGACT
TCCATATTATATTTTTCCTTTTACGGAAGCTACTAGGACA
CTAGCATGAACACAAAAAACAGAACATGCATGTGAGTTCG
CCTAAAATGTTTGAGTTTCTTCTGTTTACAACGATAAGAA
AATCTTTTAAAGAATGTTGGTTGTTGGCACCCATTGACTT
CCATTGTATTGTTTTCTGCTATGGAAGCTAATAGGACATC
AGCATGAACTGGCAGAACTGAACATGCATGTGTGTTTGCT
TATAATGTTTGAGTTGAGTAGAGATGTTTTGTAGAATGTT
GGTTGCTGGCACCCATTGACACCTGTAATACTAATGTTTG
GAGTATTTATTTCATGTGTTTGTAAATAATAGACTTAAAA
TTATTTAAAGGGACAGTTCACTCAAAACTCAAAGTTCTGT
TTTTAATTGACTCATCCGTCAAAATCAAAAACACAAAAGA
AGATATTTTGAAGAATGTTGGATGCTGGCACCCATTATAT
AGTAGATGTTGTCCTGTGGAGGTTGATGGGACGAAAGGCA
TTCTTCAAAATATCTTCTTTTGTGTTCAACAGAAAAAAAG
AAACTCAAAGCTATAAAATCACATGAGAGAGTAAAAGATG
AGGTGATTTTCATTATTGGGTGAATTATTATTATCTCTTT
AATTTATGTTTTAAATATATGTCTGTGGTTCTTGCTGATG
ATGGTTCTCTGTTGTAAATAGTCATATTTTTTGAATACAG
TGGAGCTGGTTAATTGAGGAAAAGTTCAACTTTTTTTAAT
TTTTTATTCATGACTTTAATAAATGGGTCTTTAAAATGTC
CTCTGTTTTTCTGATTAAACTAAAGACAATAAACAGTTAA
AAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations