Transcript

cu695215.2-201

ID
ZDB-TSCRIPT-141209-1655
Name
cu695215.2-201
Previous Names
  • ch73-187m15.1-001
  • ottdart00000053985
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053985 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053985|OTTDARG00000037726|ZDB-GENE-041001-198 fmn1|OTTDARP00000042417 CH73-187M15.1-001 LG_ CU695215.3 Danio rerio protein_coding NOVEL, 2873 bp
CTTTACACAGCTGTTTTGACTCTGGACGATACTGTGGTTG
ACTTGGATGCTATTGAAGCCCTGTATGAAAATAGAGCCCA
GCCTGAGGAGTTAGAGAAGATTAAGAAACACTACGAAACC
TCAGACGAAGAGCAGGTCAAACTACTGGACAAGCCTGAAC
AGTTTCTGTATGAACTCTCCCAGATTCCAGAGTTCTCCAG
TCGAGTTCACTGTTTCATTTTTCAGACCAAGTTCACTGAC
GCCGTCGCCTCCATACAGCGCAAGACCGAGATTATTCACC
ACGTCTGCAAGTTTCTGTTGGAGAAAGACAGCACAAGGGA
GGTGATGGGATTGGTTCTTGCTCTGGGAAACTATATGAAT
GGAGGCAGTCGAGCTCGAGGACAGGCCGACGGCTTCGGTC
TTGAGATTCTTCCCAAGCTTAAAGATGTCAAGAGCAGGGA
AAATCACATTAGTCTGTTGGACTACATTGTGTCCTACTAT
CTGCATCACCTTGACAAGAATGCTGGGACAGAAAAGAGCA
TCTTTCCCCTGCCTGAACCTCAAGATGTTTTCCTTTCCTC
TCAAGTGAAGTTCGATGACCTCTCTAAGGACCTCAGGAAG
CTGGGCAGAGACTTGACAGTTTGCGAAAAGGACGTCCTAA
CTGTGTGTACCAACTCGTCTCAAGAGCACATTCATCCCTT
CCAGGAGAAAATGGACTTTTTCATTGCCAGCGCACAGAAA
GAGCTGATCACCATGGAGCACCAGGTGGTATCAGCTCGTA
AAAGCTTCTCTGACCTAGTGGAGTATTTTGGGCTTAAGCC
ACGTTCTGGAGAGCAAGAAGTTGTGCCTGGCAATGTGTTT
ACACTTTGGTTTGAATTCTGCAATGACTTTAAGATCAGGT
GGAAGAGAGAGAACAAAGTCATATCCAAACAGAGACTTAA
AGAAGCCCAACAGTCAGTTCGCAACATGACAGCAGAGAAG
AAGATTGAGACGAGAAGAGCACATGCGAATGGACTGAAAG
AGAGACTGCGTATGAAAGAAGCAAGTCTGACCACCAGCTA
ACTGTTTCCAAAAAGGCTTGTATTGAAGACCCAGCTGATT
TTTGGCAAGGTCAGAATGAAGTGCACCAGCTTGTGGGACA
CTTTTCTCCAGCCTGAAAGTTGCAGGATGACTGCCTGTCT
GTCAGTGTGGATTGTGTGTATGATACAATAATCTTTTAGC
TCACTTGGATATGTATGTTCTAAATATTCCTAATGGTTCA
GATATGAGGTGAAGTTTTTAAATGAATGTTCCTTAAAAAT
AAAGATTCCAAAATTATGTTTTCCCAGTGGAACCACTCCA
TAAAGAACTGTTTAACCTTTTAAATAACCATTTTTGTTAA
TGGTGTAAAAAACATTTTAGAAATCTAAATCATTTGTTCA
CGCCTTAAAAGAACATTTTGATCAATGGAAAGGTCTGGTC
AGTAAGGGTTCTTCATGGAACCATTAAAGCCACCTTTATT
TTAAGAGTGTATTACAAGTTCACTTACTCTGCTTTATAAT
CTTCACCAGTTTGTATAATTAAGGGTTCAAATAGTGCAAA
TTGAAGACAGCAATCTTGGCATTCAACTTAGAAAAAAGCA
GTCACTTTATTTTGCATATTGAGTAACAAAAGTTGAGTAT
TTTTTATGGCCATATTAAGTCATTACATAACATAATGTAC
ATTTACAATCATATAATTTTAAACTATAACTGTTTTATTC
AGCACATCACACCTTTTTTATTGACGACATGTATGTGGAT
TTATCATTGAATCACAGTAATTTTGTTCCTTGTAAATGCA
GTACTGTACAAAATGTTCATTGTTATAAAAAAAATGTTTG
CATGCATTTCATTTGTCACCTGTATTTTCTTCATCAGGCG
AATAAAAAAGATTGTAAATATGGCACCACATATATTTGAC
AACACAGATATAAAAGCCAGCAAAACATTACTTGGTATAT
TTGGGTCTTGCTTATTTACACCCATATAGCCTTATGTGTG
CGTTTATGTATCTTACAAATCTAGCCACAGAGTACTATAT
TTGCATCAATGTGCAAATCTTCCTCCACACAGTGGAGAAT
AATATAAAAATATGTCTAATTACAACTACAGGCTACTTAT
AGTACATTAAATTGCATCAGATGAATATCTTCACAATATT
AAGACTGTTGTTTTGACTAAACAAACACATATCAATGATA
TATGTCAAGCATGTTAGTCAAGACAAACGCACGCATGTAG
CCAACAACAACAACATCAGTCAGTGAGTTTAGGTTTAATC
CAAGTCGACAGAAGTGCAGCGGCACTGTTTGACACGCCGC
ACGCGCTTTTTCTTGGTGTTGGGAGTTTGACCGGGGCAGA
AGAGCGTGTAAGTGACGGTCGTAAAACTTTTGGGCTTGCA
CACGGAGCACGACTGGAACGCGCCATCCTCTTGGTAAATG
TGTCGAGGGATGTAGAAAGAGTTGCACTGTCCGTAGCAGA
AGCGGTTGATGATGGCGCGCGGTTGGCATCCGTCTTCGTA
GATCATCAGCTTCAGCGGCTGCGTTTTACACCAGTCGAGT
TTGAGATACCGGCGCTCCGTTACGTGTAAAGCCTCCTGGC
TGGAGTCCAGCACCTCGTCCCCGGCTGAAGGCGGTCCCAT
TCCCCTGGAACCGGCCTGCGGTGTCTGCGGTGACTGCTCC
GACTGGTTTGGACTGTATTTATTTGGGTGAGGAATGGCGC
CTTGAAATCCCCCGGTTCCCCTGATCCTCGCCGGATTGCA
GAGCAGCCACAAGACCACGATAGTGACAGCTAATGCGTCT
TTAGTCATCCTTTCACATGGAGAAAGGAACAGAACATTCA
TTTCAATTCAATGTAAACTAAATCATAGGCTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations