Transcript

fmn1-201

ID
ZDB-TSCRIPT-090929-726
Name
fmn1-201
Previous Names
  • fmn1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006435 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006435|OTTDARG00000005870|ZDB-GENE-041001-198 fmn1|OTTDARP00000005728 fmn1-001 LG_ BX248136.12 Danio rerio protein_coding KNOWN, 4244 bp
TAAACCTGGAGTGGATTTTGTAACTAAAGTCACACATCTA
ATTTTACCCTCTGGAGATTTATACTTTGACTCGCTTCTAG
TTTTTTGAACTGGTGGAATGGGTTTTTGCAAATACAGACA
TAGTTAATTTGATTTTAAACAGCCTATACGCCAAACTAGA
GGAAATGGAGAGTCCGCCAACGAATTCGTTTTTGGACAAA
TTAACAAACTTGTTTACTAAACATGAACCCCAATCACTGT
CTGAGGAAAATACAAATATTATTAATTTTCACTCTTTGAC
TGGAAAAGGAGATGTTCATGGTCAACAAACATGTATTCAA
AGGCAGGATGGTTTTGATGATCAAGGTGATGATTTTGTTA
AGACTTTGCATGCAAATGCTGATGTTAACAGATCAGAGCA
TCAGAATGATGAGAAAACTGATTCTTCATCAAGAGAAGAT
CTATTGGACTTTGCCTTGGATGATAATCATGGCAATAAAA
CATTAGCAGCAGGCCAGGCTGACCAGGATGTAACAGATGG
TCAAGCTGACACACTGCCTAAATCACTTAGCCCAGTCTCA
GCCAGTGCTAAAAGTCTGGACAAACAACTTGAGGATACAG
CAATCTGTACAGAGGATAATGAGCTTGTTTTGAAAAGAGG
AGAGTTTATTTCAAAAATGAGCAATGACAGGCTCATTGAA
GATGTATTGAACAAGAAAGATGTTGAGGAATCAGAAAATG
TGGGGCTTACGCATAATGAGAAAGAAGAAGGCCACAAAGA
CGAAACCAGCATATTCAACAGCAGCGATAAAGAAACAATG
GATATTCTGAGAGAAAATGCTGAAGAAGGACCACTGAAAG
ACCTCACAGACATAAACGTTCCCTCTAACAGAAATGTTCT
GTCTGAATCTTTCGCAAAAATTAGCATATCAATGGAAAGT
CTGCAGGAATCTGCCAATGAGAGCAAAATAAGTTCTGATG
GAAACCTTCGAAACATTGCAGACAATCCAGAGGAAATCAA
AGATGAACAAGCTTTTAAACAAACATCTTCAAAGTCGAAC
ATTCAGAGCACTTTAACACCATCTGAAGATCATAGCCTCA
CTGATAAAAGGGCTTTCTTTTCAAACTCACCCGTGAGCAC
CAGAAGTGTGGTCATAACTCTTACACGTGTTGAAGCTTGT
TCTGCAGGATCGTGTGCTGATACAATCCAACCGAGTGATG
AGACTCAAGCTTCATGTAATGTATCAGACATCCATGTCCA
AACATCTACTTCAAACCAGAAGAACCAGACAGGAGGTGAG
ATTTCAGATTTTGAGCGCATTGGCACTGAAGAAGAAAGTT
CCACTTCACATGATTCAGAGAATAAAGCTAATTCAGAACA
AGAACTGGAACCTTCAGAACCACTGGAGACTGAAATGCAT
ACAGAGGGAGAAATTAATAAGGAAAATGAAGAGACCATTG
AGAACACCACTGAAACCGCTAAAGTGGTAAAAGAGAAACC
GCTTCAACTGTCGACGCTATTCAACGGGCTGCTCAGCCCT
AAGAAAGAAGTTCTTGAGGAGAAAGACGAACCAGGGCAAC
CCCGAAGCACTTCCAAACGAGGACTTTTTACAGATCAGTC
AAACAAGAAAGAAGTGAAAGCGGACTTCCTGGAACAGCTC
ACCCAATTCCTGAGCAAGGGGGAAGGAAAGAGAAAGCAAG
AGAGCATCTCGAGCCCCCCAATGTCTCCAGTCAGTCAGGA
AACTGTAGAAAATCCAGAGACAACTGTAGAGGAACCGGTC
ATTCCCCAGTCTGAGGAAACCAACAAATCTAGCAATGCAG
AGACAGCCCTGGGCGCACTAAAGGCTTTCTTTACAGTTAA
ATCTGCCAAGAAGGACTCTTCTAATCGAAAGGACCTGGAT
ATTGTGAAGAAGAAGATCAACAGGGACAAAGAAGTCCTTA
GAGCTTTCTTTGACAGAAACTCAAGCAAGTCTCCAGAGAT
CAAAGACACTACTGATTGCAAACCAGAAGTAAGTGATGAG
CACACCCCAAAGCGTCTTCAGACTGTCTGGCCTCCCCCAA
AACCTAAAGACGAGGAAGAAAAGATTGGTCTCAAATACAC
AGAGGCTGAGCATCAGGCAGCGCTTCTACAACTAAAAAGA
GAATGTAACGAAGAGGTGGAGAAATTACAGACTGACTTCA
GACTTGAGCTCTTCCGCATACAAGAGAAGAATGAGCAGAA
TTTGTCCAGACTCAGCGCAACCATTGCAAGCTTACAAAGA
GAGAGAGACAAAGTTCACCACAGAGAACACCAACATGTTG
CTGTGTCCACCGAAGACGATATCAAAGCACGGGCCGTCCG
ATCGGTGTGCATTCAGACAGACAGAGAGACATCCATCAAC
TCTGAGGAGGCCAAAGAAACCCACAGCAACAGTCTTGACC
CCCTGTTTAAAAATGGTGACCTAAACAACTCAACCAAAAA
CTTGACTGGCAAACAAAAGACAGTCCCTCCTCCATCAGCT
CATCCGCCTCCATCACCTCAGTTACAGTTGGAAAGCAGTA
AGATCACACCTCCAACTCCACCTCCTCTGCCTGGTCCTTG
TACTCCTAATATACCTCTTGCTCAGCCACCGAATAAGCAT
GTGAATGTGCCTCCTCCACCTCCTCCTCCTCCGCCTCCTC
CCATGACAGGGTCTGGTCTTCCACCACCACCACCACCACC
TCCACCTATGACAGGGTCTGGTCTTCCACCACCACCTCTA
CCACCTCCACCTATGACAGGGTCTGATCTTCCACCACCAC
CACCACCACTACCACCTCCAAATATGACAGGGTCTGGTCT
TCCACCACCACCTCCACCTATGACAGGGTCTGGTTTTCCA
CCACCACCACCTCCGCCGATGCTCCACTCTATCCCTCCTC
CACCCCCTGGATTTGGCTTCTTCTCTAAAACAGCGGACAC
ATCTCCTCGTAAGCCATCAGTGGAGCCGGTCTGTGCAATG
AAACCGCTGTACTGGACACGAATACAGATTCAAGAATGCA
GGAACGATGTTCTGTGGAGTTCCCTGAAGGAGCCAGAGAT
AATAAACACCAATGAGTTTGCAGAACTGTTTGCTAAAGCC
ACATCGCCCACCAAAAGAAAGCCCCTATCTGATGCCTATG
AGAAGAAAACCAAAGCCAGGAAGGTCATTAAATTACTGGA
TGGCAAGCGCTCTCAGGCTGTGGGCATCTTAATCTCAAGT
CTCCACCTGGAGATGAAGGACATCCAGCAAGCTGTTTTGA
CTCTGGACGATACTGTGGTTGACTTGGATGCTATTGAAGC
CCTGTATGAAAATAGAGCCCAGCCTGAGGAGTTAGAGAAG
ATTAAGAAACACTACGAAACCTCAGACGAAGAGCAGGTCA
AACTACTGGACAAGCCTGAACAGTTTCTGTATGAACTCTC
CCAGATTCCAGAGTTCTCCAGTCGAGTTCACTGTTTCATT
TTTCAGACCAAGTTCACTGACGCCGTCGCCTCCATACAGC
GCAAGACCGAGATTATTCACCACGTCTGCAAGTTTCTGTT
GGAGAAAGACAGCACAAGGGAGGTGATGGGATTGGTTCTT
GCTCTGGGAAACTATATGAATGGAGGCAGTCGAGCTCGAG
GACAGGCCGACGGCTTCGGTCTTGAGATTCTTCCCAAGCT
TAAAGATGTCAAGAGCAGGGAAAATCACATTAGTCTGTTG
GACTACATTGTGTCCTACTATCTGCATCACCTTGACAAGA
ATGCTGGGACAGAAAAGAGCATCTTTCCCCTGCCTGAACC
TCAAGATGTTTTCCTTTCCTCTCAAGTGAAGTTCGATGAC
CTCTCTAAGGACCTCAGGAAGCTGGGCAGAGACTTGACAG
TTTGCGAAAAGGACGTCCTAACTGTGTGTACCAACTCGTC
TCAAGAGCACATTCATCCCTTCCAGGAGAAAATGGACTTT
TTCATTGCCAGCGTGTACTGTGCGTTATTATGTATTTTCT
TCCCCAGCTTCTCTGACCTAGTGGAGTATTTTGGGCTTAA
GCCACGTTCTGGAGAGCAAGAAGTTGCGCCTGGCAATGTG
TTTACACTTTGGTTTGAATTCTGCAATGACTTTAAGATCA
GATGGAAGAGAGAGAACAAAATCATATCCAAACAGAGACT
TAAAGAAGCCCAACAGTCAGTTCGCAACATGACAGCAGAG
AAGAAGATTGAGACGAGAAGAGCACATGCGAATGGACTGA
AAGAGAGACTGTGTATGAAAGAAGCAAGTCTGACCACCAG
CTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations