ZFIN ID: ZDB-TSCRIPT-141209-1650
Transcript Name: csf3b-202
Previous Names: csf3b-002, ch1073-205c8.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053970 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053970|OTTDARG00000037720|ZDB-GENE-141212-221 csf3b|OTTDARP00000042406 CH1073-205C8.2-002 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 843 bp
AGGAAGAGCATCCGCCGGTAAACACCGGCTCGAGTAACCC
CGAGGACTGACTGACTGTTTCCTTCTTTTTGTCAGTGTTT
TTCGCAACGCTTCAGACGCAATAACGCGACGCCGATCAGT
CATGGAAGTTTCCCCAGTTGAACAATCAGGCTCTTTAAAA
GCCTCCAGATCCGCACAGCAGCACCCAACACCGGACACCG
AGCACCGGCGAGCCGCCATGAAGACCTGCTGCCTCCTTCT
GCTGCACCTCTGTGTGTGCCAGCTGCTGTGTGTGCCCCTA
CAGCCACAGCTAACACACACACACACTGAACACACTCTGA
GAGCCTTGAGTTTGGCCAAGAAGATCCTAAACGACATTCC
AGCTGTGCAGGAGCTCTGCGCACCCAACACTGGTTTGAGT
TCCTCCACTGAGGAGTTTTTATCCAGTGAGTTCCAGATCC
CGACGTTGCCGCTGCTCAAATCTGAGGATTTAACACTGGA
GGAGCGTGTGCAGCGGATGCTCATCGGTCTGGAGCTTCAT
CACAGAGTCCTGCTGAAGCTGCTGGAGCCCTGCCGCCCAG
AGAACCTACTGAACGACCTCGCAGAGCTGCGCACGCTGCT
CCTCCTCCAGGTGCCCTCTGCTGGTCCTCAGGTGTTGCCG
CACACACACACTCTCTCGGCTCCACTCAGCCAGTTCAAGC
TGCAGGTGCGTGTGCGCGCGACACTCCGGCAGCTGCGCAG
CTTCATGCAGGACGTGTTCCGCAGCCTGCGCTGCATCAGT
GTGTCTCAATGCTAACTGCACGCACATACACACACACCAT
GACTTTCGCTACATATTTATATATTTAATATTTATTGTTT
TGA

csf3b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA csf3b-201 (1) 957
csf3b-202 843
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csf3b-202 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER csf3b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053970 (1)
  • Ensembl_Trans:ENSDART00000166748 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH451519 (1) 852bp
    CITATIONS (2)