ZFIN ID: ZDB-TSCRIPT-141209-425
Transcript Name: csf3b-201
Previous Names: csf3b-001, ch1073-205c8.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053969 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053969|OTTDARG00000037720|ZDB-GENE-141212-221 csf3b|OTTDARP00000042405 CH1073-205C8.2-001 LG_ CU929079.6 Danio rerio protein_coding NOVEL, 957 bp
GAGTGCGCATGCGCTCCCGGTGTTCGCCAGCGTAGACACG
CGGTGCAGTGTTTTTCGCAACGCTTCAGACGCAATAACGC
GACGCCGATCAGTCATGGAAGTTTCCCCAGTTGAACAATC
AGGCTCTTTAAAAGCCTCCAGATCCGCACAGCAGCACCCA
ACACCGGACACCGAGCACCGGCGAGCCGCCATGAAGACCT
GCTGCCTCCTTCTGCTGCACCTCTGTGTGTGCCAGCTGCT
GTGTGTGCCCCTACAGCCACAGCTAACACACACACACACT
GAACACACTCTGAGAGCCTTGAGTTTGGCCAAGAAGATCC
TAAACGACATTCCAGCTGTGCAGGAGCTCTGCGCACCCAA
CACTGGTTTGAGTTCCTCCACTGAGGAGTTTTTATCCAGT
GAGTTCCAGATCCCGACGTTGCCGCTGCTCAAATCTGAGG
ATTTAACACTGGAGGAGCGTGTGCAGCGGATGCTCATCGG
TCTGGAGCTTCATCACAGAGTCCTGCTGAAGCTGCTGGAG
CCCTGCCGCCCAGAGAACCTACTGAACGACCTCGCAGAGC
TGCGCACGCTGCTCCTCCTCCAGGTGCCCTCTGCTGGTCC
TCAGGTGTTGCCGCACACACACACTCTCTCGGCTCCACTC
AGCCAGTTCAAGCTGCAGGTGCGTGTGCGCGCGACACTCC
GGCAGCTGCGCAGCTTCATGCAGGACGTGTTCCGCAGCCT
GCGCTGCATCAGTGTGTCTCAATGCTAACTGCACGCACAT
ACACACACACCATGACTTTCGCTACATATTTATATATTTA
ATATTTATTGTTTTGAACATTTGTTATTTTGGTAGCCGAC
ACATGTTGTGTTTAACACATGTTGACCGACACATGTTGTG
TGTTTAACACATGTTGTGCCCTGTGGGTGCGCTGTAATGT
TCTATTTAAATGTATTTATTATTAAATTATTTTCCTG

csf3b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA csf3b-201 957
csf3b-202 (1) 843
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csf3b-201 Contained in:
[Fosmid] CH1073-205C8 (1) (order this)
OTHER csf3b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053969 (1)
  • Ensembl_Trans:ENSDART00000165921 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH543513 (1) 910bp
    GenBank:EH565518 (1) 883bp
    GenBank:EU267077 (1) 558bp
    CITATIONS (2)