Transcript

unc93b1-202

ID
ZDB-TSCRIPT-141209-1501
Name
unc93b1-202
Previous Names
  • unc93b1-001
  • dkey-224i13.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048538 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048538|OTTDARG00000034324|ZDB-GENE-130424-1 unc93b1|OTTDARP00000038069 DKEY-224I13.3-001 LG_none CT583626.15,CR381666.6 Danio rerio protein_coding NOVEL, 2489 bp
GATTGGGTCATTTATGGATAGCCCGGACTTCAAGCACTGT
CCCTTTAAGAAAATAGGGAACTAGTGAGAAAACTTTCATT
TCCTTGTCTGTTTTCTTTATAATAGCCACACGCGACTTTT
TATAAGGGCAATGTTTCGCTAGAAGCTCGATTTAAGTTCC
TAAAAGTTAACTTTTATTATTTTAAAAGACTTTGCAGTCT
TTGTTGCTACAGCGACGTTCATCGTTTTCCACTTCGTGAT
CTACCTGCAGTATTGCAGTTGTCAGTGAGTCTCTCAACCG
CGAGATGGCAGCACTGATCGCTGACGATAACGTGTACCGC
GAGGCGGAGCTAGACGGCGCGCCCCCTGCTGAAGCAGAGG
ATCCACCGCAGCTGCCCGGACCTGAGGGAAACATACAAGG
ACAGGTGGAGGAGTTTCTCGGCCCACATCCAGACTACGAT
GAGGAGGAGGAGGAGCGCAAGTACTACAGGCGAAAGCGGC
TGGGTGTAGTGAAGAACGTGGTGGGGGCCAGTTGCGGAGG
AATGATCATCTACAGCGTCTACATGGGTTTGTTACAGATG
CAGTTGATTCTGCACTACGATGAGACGTACCGAGAGGTCA
AGTACGGCACATTAGGGCTGGAGGACATTGACAATAAAAT
GCTGATGGGGATCAACGTTACGCCTATCGTCGGCCTGCTC
TACACACCGGTGCTCATTAGGTTTCTGGGCACTAAATGGA
TGATGTTTCTGGCGTCAGGCATCTATGCTCTGTTTGTTTC
AACCAATTACTGGGAGCGATATTACACTCTTGTGCCGTCA
GCGGTGGCCATCGGTGTCGTCATCGTTCCACTGTGGGCGT
CAATGGGAAACTACATCACTAGAATGGCCCAGCAGTACTA
CGAGTTTGTGAATTACAAGGATGAAAATGTCCAGGAGCAG
AAAAAACCTCCCAAAGGAGCTTTCCATTCCTACATCATCA
TCTTCCAGTCCGTCTTCTACATCATTTTTCATCTGAGTTT
CGTGTTTGCCGAGTTCCCCACGGTGCTGTTCCTCAATAAC
TATCTGAATGATTACAGACATACTCTCTTCAAAGTCTCAC
AGTGTGGAGCCGGCGGCAAAGGAGTGATTGAGAATTTCAA
TAAGACGGTTTTGAAGAGTCTGCCTCGCTCTCTGCTGCTT
ATCGAGGTTGAGAGTGCGCTTATGGGAGCAGCGTTTCTCT
CCATGCTCATATTCCTGCTGCTGTGTGGAGCTGCATACCG
GCCCACAGAAGAAATTGACCTGCGCAGCATTGGCTGGGGA
AACATCTTCCAGCTGCCCTTCAAGCACTTACGAGATTACC
GCATCCGCCTGCTCTGCCCGTTCTTCATCTACTCTGGCTT
TGAAGTGCTCTTTGCCGTCCAGGGCCTCACACTGTCATAT
GGAGTGTGTGCAGTGGGCATGGAGAAGCTGTGGCTGTTGG
TTATGGTGTACGGTTTGTCATCCTCCATCTGTTCGGCTCT
TGCTTTGGCATTGTTGCGATTGCCCAGGCCCGTTATTCTC
CTAGCAGGAGCGTTTGTGCACTTCGTGTTGATCATCGCTC
TGATGTGCTGGTCGCCCACTCCTCGGGACACCAGCCGTCT
TCCTTATCTGCTGGTGGTCTCTGCACTTTGGGGCCTGGGC
ACTGCCCTTAACAAAACCGGACTGAGCACTCTGCTGGGGA
TGCTGTATGAGGACAAGGAGCGACTGGACTTTGTTTACAC
CATCTATCATTGGTGGCAAGCTATTGCCATCTTCATCGTC
TACCTCTGGTCTGCATTACCTATGCGGGCTAAGCTGGGGC
TGCTGTTGTTGACTCTCCTAGTGGCGTCTCTCTGTTACGT
GCAGATGGAGCGACGTCTGGCCAAGAAAATTCCCTTCAGG
TTGCCACGAATCCCCCGTCCTCGACACAAGGTCAAAGGTT
ATCGATACCTCGAGGAAGAGAATTCTGATGAATCCGACAC
AGACCTGAGTGATGCAGACGACGATGATGATAAAGAGGAG
GACGAGAGGATGTTGGTGGAGGAGGACAGAAATACAGACG
GCGATTCCCAGGGATCACCGGGACCAGAGAGGAAGCGGGT
TCGAGACCGCAGGAGGAAACACGACAACACTGCCTACGAG
CAGGCCGGAGAGAGAGACGACTACGTTCAACACTGAACAA
AAACTGAAAAAAGAAGAGGTGAAAGATGAGCCTGTGCTGA
AAAATACTGAATAGCAAGATTGAAAGAGAAGCAATGCTAA
AGGGATATATTTCCTCACTTTTTTCCATTAAATATGTTTT
TTTTTCGTTAGAAATGAAAAGTGAGGGTCGCTGATGAAAA
ACGTTAGGTCAGAAAGTAGTGTACAGTTAAACAAACATAC
CAAAAAAGTGGAAGTGACAAGAGCCATTTTCGTATCATTG
AAAGGGGAAGTGAAAGGAGGAAACGGTGGATAAGTTCAGG
TGGTTTGTTGCCATAGAAATAGATATTCTCCGTTTTCGAA
CGTGATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations