Transcript

smx5-201

ID
ZDB-TSCRIPT-141209-1454
Name
smx5-201
Previous Names
  • smx5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046077 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046077|OTTDARG00000032906|ZDB-GENE-000616-10 smx5|OTTDARP00000036359 smx5-001 LG_ FP101882.5 Danio rerio protein_coding KNOWN, 752 bp
GGATTAACCTGAGCCCTGGACTGTGCTTTATTATTATTTG
TCTCCATCTGCTGACGAAAGAGGGAATTGCCAGAAAAGAG
GAGCCATCCAATAGAAGCACAGAGTGAAAGACCCGGCAGC
TTTTTGATGACGTATGTGATCTAAAGCACAAAGCCGCGTG
AAAATGCTCTTCTACTCGTTTTTCAAGTCTTTGGTTGGCA
AAGATGTTGTGGTGGAGCTCAAGAATGACTTGAGCATATG
TGGAACATTACATTCAGTTGATCAGTACCTGAACATCAAA
CTGACAGATATCAGTGTTACTGATCCAGAGAAATATCCGC
ACATGTTGTCTGTGAAGAACTGCTTCATTCGTGGATCAGT
GGTGCGATACGTTCAGCTTCCTGCAGATGAAGTGGACACA
CAGCTACTACAGGATGCTGCACGCAAAGAAGCTACACAAC
AGAAACAATAATGTTTATATTTGAGAATAGTTTGGTTTTG
TTCCAATGTTCAGAAGCATCATCTGTGGAGTTTTGTTGAT
TTAAATGTTTTTCTTACCTAAAACATGTAAAGTTTTTTTT
TTCTCTTTCATTTTTACGTCATGTGAAGCCTGTTATTGAG
GGTGTGATTTACTGTTTTTTTTTTTTTACTTCACAAGTTA
GTGGTTGTGTGCTTTTAATGAGTGTTGGTAAAGTTCTGTA
CTGCATACCAATGACTTTTAGTTAGGTTCACACATTGATG
CAAAAATAAAGTATTTTCCTCTGTTTTCACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations