header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1337
Transcript Name: vcam1b-201
Previous Names: vcam1b-001, ch211-190n7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030531 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030531|OTTDARG00000023440|ZDB-GENE-070209-238 vcam1|OTTDARP00000024873 CH211-190N7.3-001 LG_ BX908733.16 Danio rerio protein_coding NOVEL, 3475 bp
GGGCGGAGCTATCAGCAGGCGCACTGACTGCACGTCGCAG
GGAAACGGATAAGTAACCTACATTATCTAATAATTCATAT
ACAGAGCATTTTAACATGATTAAAAACACACATCGTGTCA
CTTATGCATTCCTCATCATGAAAACACTTGCTGGATAACA
CTGAGTCGAACATGTTAACATTCATGGTTGTTTTAATGTA
TTTTTAGATCTGAGGTAAATTATCCATTGTCGCCTTCATG
TCCATACAGAATTATAGTCTACCGTCGAGGTTTTGCGCCT
GCTAGCTGTTATATGAGTGTACACAGTGATTTCCTGGAAA
CCCTGTCAGGACAGCAGAGGGAGCCTGTGGTGGATGGAGA
ACTTCTGCTCGCCTCTCTTCTTGGTCCAAACAAAGGATTG
AGGGATGGGGAATTCCTTCATGGCTTATTTAGGGCTACTA
TCCCACCCCCTTCTCATATAAATGAGATCCAGAGCTGAAT
GAAAGCAAGATCACTAACTCATTTTCACTCCCTTGGAGCA
CTTGGAAAAATTCTTCATAAGTGTACAACATGGATACAGC
TTTCTTGCTGACTTTGCTTTTGCCAGTTGCAGTTGTTTCC
CACACGCTGGAGCTGCCGCGCAGTGTTCAATTTAAAGTGG
GCGACAGGAATGAGCTGAGATGCAGGATGTTATCTTGCCC
AGAGAAGGTGAAGTTTGTCTGGACCGCGTTAGGAGACAAA
CCGATTTTTGCCACTCCAAAGACGGGGGATAAAGAAACTG
TCCTGATCTTTGACAATGTGACGAAGAATCACGCCAACGC
CATAGTGTGCAGAGCTGCCTGCGGAAAAGAGATGAAAGAA
TTGACCACACAGGTTAATGTTTACTCTTTTCCAAGAAACC
CAGTTATATCCGGATATGATCACTTGATAATGGGCAAGGA
AAACATTTTGTCCTGTGAAGTGTCTTCTGTGTACCCGTCG
GAGTACTTTGATGTGGAGTGGTTATATGAAAACAGGGTTG
TTCATAGGGAGAGTGGAGACTTTGATAAAGATGCTGTTTC
CATTCCTTACACATTTACACCTTCAAGTGAGGACGATGGA
AAGGCAATAACTTGCAGAGCATCCCTCAATATTGAAGGTG
TACCACCCGAAGAGAAGACCAAGGAGACGTCTAGACACAT
CAAAGTACTTTCTGCACCGCATAACGTTGAAGTATCTGGA
GAGACCGCAGTCTCACTGGGATCCAGTTTAACTTTGACCT
GTGAGGCTGAAGGCAATCCAAAGCCTGCTTTTACATGGAC
GGCTCTTAAACCAGATGGCCATTCTGTGGAACTGGGAAAA
CAGCGAGATCTCTTCATGCATAATGTGTCCTTATCAGATG
CTGGAACTTACCAGTGTAATGTTAGCAATGACTTGGGAAA
CCAGATGGTCAACGTTTCAGTGGTCGTTCAAGCACCTCCT
GTGGATACTCGCATTGTAGCAAGTCCACAGTCAAGTCTGA
ACGAAGGAGATTCTGTGACCATTTTCTGCAAGTCCAGTGG
GGTTCCTGTGACACGTGTGGTCCTTAGTAATGTTGCAAAA
ACTATACTAAAAACCAAAGAAGGAGCTGAGACATCAGTTA
CCATTGACTCCGTCAAGCTATCCGACACGGGCATGTTTGT
TTGCGAGGCTTTCAATGAGTATGGCAGTCAGAGGACCACT
CTTAATCTAAATGTTGAGGCTCATTTGCTGGAAGTGGAGC
TACAACCAAATGGCACGGTGGTGTCCGACAGAGGCTCCAG
TTTGGTGCTGTCTTGTCAGGCTTCAGGTTGCCCTCATCCC
GAGTTCTCCTGGAAGAATCTTTCAAACATGTCAGTCCACA
GGCAACCTAAAACTGATGGCTCTCTGTCCCAGCTGCTCTT
TGATCCGGTGGAGGTGGAGGATGAGGGAACTTACGTCTGT
GAGGTCACATGTGGCTCAATCAAGAAGTCCAAGCAGACGG
AAGTGAAGGTGTTTTCATTTGCAACATGTCCTATCGTAAA
AAGTTCTGGACCTTCCCTGGCAGGAGAGAGGATGAAATTG
ACCTGCACTGTTCAAGACGTATTCCCTGTCAACCTTTTCC
AAATTCTGTGGCTGGATGGAGAAAGAGAAATCTGGAGAGA
GGAATCTCAGTCATTTTCAAGTGGATCAACAGATCTGACT
TCGGTTTATTCTTTACAAGTAGACGCCGAAGACCAGGACA
GACATATCACCTGCAAGGTCTTGCTGGACATGCATGGTGT
GCCACCTTCACAAGTAGTGAAGACTGCATTTACTACATTG
TCCATTCACTATCCCCCTAGAGCCACAAGGATTATTGCAA
GCCCACTGACAAAGTTAAAGGAGGGAGAACCTGTGAGCTT
TTCTTGCCTTTCTGACAGCTTTCCTGCAGGGCGTATGGTG
CTAAGCAGGGTTGTGGATGGCATACGAACAGAGCTAAAGA
CCATTGATGGGGTTGAAACTTTATTTACCCTACCTTCGGT
TACGCTGGATGATGCTGGCATCTACGTTTGTGAAGCTTCT
AATATTTATGGGAATCACAGCGACAGTCTGGAGATTACCG
TGAAAGCACCTCCCAGGAATACGACAGTGGAGATCTTCCC
ATCCACAAATGTTCAGGAGGGGCAGAATATCACCATCTGT
TGTCGCTCCGTGAGTTTCCCTCCACCTGCGGTGGTCCTCA
GCAAGCTGGATAGCGAGACAAACATCTACTCCCTTGATGG
TGTCTTTATACTAATGAACCTCACTCCAAATGACACAGGC
CTATATCAGGTCAATGTCACAAACGACCTGGGTTACGAAA
CAGAGGTTTTCAATATCAATGTGATAGAGAAAAGATTGGA
CTCTCCATTGGGTTGGACTGACTTTTTAACCCTAGCCATT
TTCTTGGGAGGTTCTGCTGCTCTGCTTGGTCTTGTGCTGT
ATGTGTGGAGAGAAAGAAAGAAGGGGTTTTATGATCTTAC
GAAGGGCATTATATAAACAATGAATAGACTCCAGTAAGTG
TTTCAGAAGCAGCTAAGCTGTCGTATCAGGGCCCCGGGGC
CCCCTAAAGTGAGAACTGCAGGTGACTGGATTGATCATCT
GAAACTTCAGGTGAAATTAATACCTGAGTCCGCTGTGAAC
CTGCAGTCTCCACAGGCAGAGATCATCAATGTTCCTGGGA
TTTGCTTGCTCAGAGGAGGTAACTGAACTGGTGTGGTTCG
TTCTCGTTCGTTGTATGTTGGGAGATCTTTGAGACCCCCT
GTTTTGCACTTAAAGCAGTTTTAAATATAATTGAAATTTG
GGATACAAACTGTGAAACATTAGCATTGTAACCTAGCCAC
AAAATTTGGTACATTTTAGATCACAACAATCAGTTTGCTG
TACTCAAGTTGACAACACAAACAAATTCTGTATTTAATTC
AGTGTGGTGATTGTATCAAATGTTTTCATTTTGATATTTA
TTAAACAAAACAGCTTTGTCATTTGATCCGAGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vcam1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030531 (1),  Ensembl_Trans:ENSDART00000090390 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC133177 (1) 2995 bp
GenBank:EB778996 (1) 457 bp
CITATIONS (2)