ZFIN ID: ZDB-TSCRIPT-141209-1328
Transcript Name: eif2b1-201
Previous Name: eif2b1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030062 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030062|OTTDARG00000023134|ZDB-GENE-040625-25 eif2b1|OTTDARP00000024514 eif2b1-001 LG_ CT978957.10 Danio rerio protein_coding KNOWN, 1218 bp
CGACTGTTCACTCGACATAAAACAACGAAGAAGAAGAAAG
CGAGCGTGTCCACTTGTTCACTGTAAATAGCCTTTCATTT
GAAATACACTAGAAGAATAGATGTTATTCAGTTTCTGAAA
GGGATCGTATGAAATAAATGGGTAAAGCAAGCATTACTTT
GTAGACAAACTTTAAACAATTCGTCGTACTGGATGTCAGA
GAGCGTCATGACAGATCGTTGCATCAGCGACACTATCATT
ATTAGCTCGTGAAACTCAAAACTTGACAGATCTCTGAGAG
AGAAAGTGCTTTTAAAATGGAGGAAAGAGAACTGGTGGAG
TATTTCCGTGGGCAGATCAGGGAAGATCCAGATGTGGCTT
CAGCGGTGGCTGCGATTCGATCACTGCTTGAGTTCCTGAA
GAGGGATCAGAGTGAAACGATTCTGGGCCTGAGAGAGAAC
ATGACTCAGGCCATTCACAGGCTGCAGGAGGCCGATTCAT
CCGTCGCCGTGTCATCTGGCGGAGAACTATTCCTGCGCTT
CATCAGTCTCACATCACTGGAACATCCGGATCTCTCCCAG
TGTAAGAATGTGATGATCGAGCGAGGTGAACTCTTCCTGA
AGAAAATCTCCCTCTCCAGGGGGAAAGTGGGTAAACTGTG
CCACACCTTCATCAAAGACGGCGCTAAAATCCTGACCCAC
TCCTCATCTCGAGTGGTCCTGAAGGTTCTGGAGAACGCAG
CGGCTGATAACAAACGCTTCACAGTTAAACTTATGGCTGA
AAAACTCCGCAAGCTCAGCATCCCAGTCACAGTAGTGCTC
GACGCTGCAGTCGGGTATATCTTGGAGAAGGTGGATCTGG
TGATTGTCGGTGCAGAGGGAGTTGTGGAAAGTGGAGGTGT
TATAAACAAGATCGGCACCTATCAGATGGCTGTTTGCTCT
AAAGCACATAACAAACCTTTTTATGTGGTGGCAGAGAGCT
TTAAGTTTGTGCGACTTTATCCTCTAAACCAGCAGGACGT
GCCTGATAGATTCAAGTATAAGGCGGATGTGCTGAAGACA
GCGGAGGATCTGAATCAGGAGCACCCGCTGATCGACTACA
CTCCTCCATCCCTCATCACTTTACTCTTCACAGACCTCGG
TGTGTTGACGCCGTCCGCCGTCAGCGACGAGCTCATCAAA
CTCTACTTATGATCGTAATAATCATGATTATTGCTGTTTA
TAAAGCATTTCAATCATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif2b1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030062 (1),  Ensembl_Trans:ENSDART00000011192 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071346 (1) 1176 nt
GenBank:AI641146 (1) 533 nt
CITATIONS (2)