ZFIN ID: ZDB-TSCRIPT-141209-1326
Transcript Name: vps33a-201
Previous Name: vps33a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030047 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030047|OTTDARG00000023124|ZDB-GENE-040914-82 vps33a|OTTDARP00000024504 vps33a-001 LG_ CT978957.10 Danio rerio protein_coding KNOWN, 2525 bp
AGTCACATGACTGCGCTTTGGCGAATATGGCGTCACATTT
GTTTTGCGGTAGAGTAAACCTAAATATTTTGAGAGAGGCT
GCACGAAAAGACCTGCGCGAGTTTTTGGATAAATGTTCGG
GAAGCAAGGCCATTGTTTGGGATGAGTATCTAACAGGACC
TTTCGGGCTGATTGCTCAGTATTCACTTTTGAAGGAACAT
GAAGTGGAGAAAATGTTCACTCTTAAAGGAGGCCGAATAC
CATCTGCCGCCGTCAAGAATATTGTCTTCTTTGTTCGCCC
GAGGTTGGAGTTAATGGACATCATTGCAGAAAATGTTTCG
AGTGAGGATAAACTGCAGCCTCGTGAGTTTCACATTTTGT
TCGTGCCTCGCCGGAGCCTCCTGTGTGAGCAGCGGCTGAA
GGAGAAAGGCGTCCTGAACTCCTTCACAAACATCGACGAG
TACATCCTCGACCTCATCCCTTATGATGGAGATCTGCTTT
CCATGGAGTCTGAGAGCTCCTTTAGAGAGTGTTATTTAGA
AAATGATCAGACGAGCCTCTATCATGCTGCCAAAGGCCTC
ATGACTTTGCAAGCACTTTATGGAACAATACCACAGATAT
TTGGCAAAGGAGAGTGTGCACGGCATGTGGCCAACATGAT
GCTGCGGATGAAGAGAGAGTTTGCAGGCAGCCACACTCAG
ATCCTGCCTGTGTTTGACACTCTTCTGCTGCTGGATCGAA
ACGTGGATTTACTCACACCGCTCGCCACGCAGCTCACATA
CGAGGGTCTCATCGACGAGATCTTTGGCATCACCAATGGT
TATGTGAAGCTCCCGCCTGAAAAGTTTGCTCAGAAGAAAC
AGGGTGAAGGCGGCAAAGATCTGCCCACCGAGCCCAAAAA
ACTGCAGCTGAACTCCGCTGAGGAGCTTTACGCCGAGATA
CGCGACAAGAACTTCAATGCTGTCGGTGCGGCTCTCAGCA
AGAAGGCCAAGATTATTTCAGCAGCGTTTGAGGAGCGACA
CAACGCCAAAACTGTGGGAGAAATTAAGCAGTTTGTTTCC
CAGCTGCCGCACATGCAGGCGGCGCGCAGCTCTCTGGCCA
ATCACACCTCCATCGCTGAACTTATCAAAGACATCACCAC
TTCAGAGGTTTTCTTTGACAGTCTGACGGTCGAGCAGGAG
TTCATGACTGGAGTCGACACAGACAAGGTCAGCACTTATA
TTGAGGACTGCATTGCGCAGAAAGACCCGCTGATAAAAAT
CCTGCGGCTGGTCTGTATGCAGTCTGTCTGCAACAACGGA
CTCAAACAGAAAGTTCTGGACTACTATAAGAGGGAGATCC
TTCAGACGTACGGTTATAAGCACATTCTGACCCTCAAGAA
CTTGGAGAAGGTTGGTTTGCTCAAACCTCAGAGCACCATG
AGGAACAACTACCCCACAATCAGGAAAACACTCAAGCTGT
GGATGGAGGACGCCAACGAACAGAACCCGAATGATATCTC
GTACGTGTACAGCGGCTACGCTCCGCTCAGCGTTCGCCTC
ACTCAGGTTCTGGCGCGACCAGGATGGAGGAGCATCGAGG
AGGTGCTGAAGATGCTGCCTGGGCCACACTTTGAGGAACG
ACAGCAGGTTCCCACAGGCCTCCACAAGAAGCGTCAGCCT
GGAGAAAACCGCACCACTTTAGTCTTCTTTCTGGGCGGCG
TGACGTACGCTGAGATCGCCGCTCTGCGTTTTCTCTCTCA
TATGGAGGACAGCGGGACCGAGTACATCATCGCCACCACC
AAACTGATCAACGGCACCAGCTGGGTCAAATCTCTGATGG
ATCACCCAGAGGAAAACCAGCAGTGACGATCAATCCTGTT
TACGTTATTAAAACTGTCGATGCTGTTTTGTCGGATTATT
ATAATAACCGTCAAGCTGCCTTTTCTGTTGCCTGTTTTGA
TACTAATTTATTAGTCAGAAGACACTTAAGCATCTTTCTA
CGACTGGTACAGTAATGGTTCAGACTTTACAGTGAGCTTT
CATTAGTTAATGTATTTACTAACAATGATTGATACTTGTA
AGGAATTTATTCATCATAGTTCAACATTTACTAATGCTTT
ATTAATGTCCAAATACATGCTGGATCATTAATGCACTGTT
AGTTAACATGAACTAATCAATCACTGACATTAACAAATAC
TGTAATAAACGTATTGTTCTTTGTTTGTTAATACATTAAC
TAATATAACCTTATTGTGAAGTGTTACCCAGTAATGTAAC
TGCATAAACATGCAAATGTGTTTAATAACCCTCTTTGGAT
ATTTCCCTGTTAGCAACTTATTTGAAAATGCATCCCTGGT
CTGTGTGAAATGAAAACTATGTCAGCTTGAGCACATTCAT
ATTTCACTTATTTACGGTTCACTGTAAAGTAGTGGTTATT
GACAATAACGGATTAAATCACTTAAAGATAATGACTCTAT
GGTTACTAACTCAATGTTAATCTGAACCTGTACTATATTC
ACTCTCCAGAGGAAAATAAAACTTATTTCTTTTTTTTACA
CAAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps33a-201 Contained in:
OTHER vps33a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030047 (1)
  • Ensembl_Trans:ENSDART00000167388 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095344 (1) 2559bp
    GenBank:BQ450290 (1) 640bp
    CITATIONS (2)