Transcript

slc12a1-201

ID
ZDB-TSCRIPT-141209-1204
Name
slc12a1-201
Previous Names
  • ch73-34a12.1-001
  • ottdart00000062234
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062234 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062234|OTTDARG00000043018|ZDB-GENE-080130-3 slc12a1|OTTDARP00000048628 CH73-34A12.1-001 LG_18501 1 CABZ01112816.1,CABZ01112817.1,CABZ01112818.1 Danio rerio protein_coding NOVEL, 1983 bp
GTTTGGGGATAGTGGTGGTGTTGTTGAGTATGGTTGTAAC
CAGCGTCACCTGTCTGTCCATGTCAGCGATCTGCACTAAC
GGAGTGGTGAGAGGAGGAGGAGCGTATTACCTCATCTCCC
GCAGTCTGGGTCCGGAGTTCGGCGGCTCCATTGGTCTGAT
CTTCGCCTTCGCCAATGCTGTGGCCGTGGCCATGTATGTT
GTGGGATTCGCTGAAACTGTGGTGGAGCTTCTCAAGGACA
GTAACGCCCTCATCGTGGATCCCACAAATGATATCCGGAT
CATCGGCTGCATCACGGTGGTGCTGCTGATGGGCATCACT
GTGGCTGGGATGGAGTGGGAGGCAAAGGCTCAGGTGGCTC
TGCTGGTCATCCTGCTGGTGGCCATTGCTAATGTGTTTGT
GGGAACAGTGATTCCCTCCACACAAGACAAACGCTCCAAA
GGCTTCTTCAACTATCACGAATCCATTGCAAAGGAGAACT
TCATACCGGACTTCCGGGACGGAGAGACCTTCTTCTCTGT
TTTCGCCATCTTCTTCCCTGCGGCCACTGGGATCCTGGCT
GGAGCCAACATCTCTGGAGATCTGAGGGATCCTCAAGGAG
CTCTGCCTAAAGGGACTCTGCTGGCCATCTTCATCACCGG
GGTCACCTACCTGGGCATCGCACTGGTCGTCTCGGTCACA
GTCGTCCGAGATGCGACGGGAAACAGAAACGACACCATTC
AAGCCGGTGCGAGCTGCAACTTCTCCTCTGCCTGTGATTT
CGGCTATGATTTCTCCATCTGCCAGACCACCAAATGTAAC
TACGGCCTCATGAACAACTTCCAGGTAATGACTCTGGTGT
CTGGATTCGGACCTCTCATCACTGCAGGAACGTTTTCGGC
TACGCTCTCCTCAGCTCTGGCGTCTCTAGTGAGCGCGCCC
AAAGTCTTCCAGGCTCTGTGCAAAGACAACATCTACAAGG
CGCTCAAGTTCTTTGCCAAAGGTCACGGGAAAAACAACGA
GCCGATCCGAGGATACGTCCTGACCTTCATCATCGCCGTA
GCCTTCATCCTCATCGCTCAGCTCAACACCATCGCCCCCA
TCATCTCCAACTTCTTTCTGGCCTCGTACGCCCTCATCAA
CTACTCCTGCTTCCACGCCTCCTACGCCAAATCCCCAGGC
TGGAGGCCGGCGTATAAATACTACAACATGTGGCTGTCTC
TGTTTGGAGCCGTGCTCTGCTGTGCTGTGATGTTTGTTAT
TAACTGGTGGGCCGCGCTGCTCACATACGGCATCGAGTTC
TTCCTCTACATCTACGTCACCGTCAAGAAACCAGATGTGA
ACTGGGGATCTTCAACTCAAGCCGTGACGTTTATAAACGC
AGTGAACAACGCTCTGATTCTATCTGGAGTAGACGACCAC
ATCAAGAACTTCAGACCCAAATGTCTTGTCCTGACGGGAT
CTCCCAGAAGTCGGCCGGCGCTGCTGGACCTCTCACACTC
CTTCACCAAGAACTATGGGTTGTGTTTGACCTGCGAGGTG
TTTGTGGGTTCCCGTGATAAGAATCTGCAGGACATGATTG
AAGGCGATGTGCAGAACCAGCTGTGGCTCAACAAGCAGAA
ACACAAAGCATTTTACACACCCATCGCCAGCGACACACTC
AGAGACGGAGCACAGGCACTGATGCAGGCGTCAGGACTGG
GCAGAATGAAGCCGAACACAGTGATGCTGGGGTTTAAGCG
TGATTGGAGAACCAGTAAACCACAGGACGTCCAAAACTAT
GTAGGAATTCTCCACGATACGTTTGACTTTGAGCTCGGGA
CAGTGATAATGAGAGTCAGTCAGGGGATGGACATCTCACA
CATCCTCAAAGCTGAAGAGGAGATGGAGCGCATGATCTTG
GAGCAGCAGGCGCTGGAGATGGAGGAGAATGACTTTCAGC
CTGGACCGAGAGGCTTCTTCAATCGGGCCAAGAAAACCCC
AAAAAAAGAGCCGACCAGCAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations