ZFIN ID: ZDB-TSCRIPT-141209-1161
Transcript Name: gtf2h1-201
Previous Name: ottdart00000062068

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000062068 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000062068|OTTDARG00000042939|ZDB-GENE-040912-164 gtf2h1|OTTDARP00000048530 gtf2h1-001 LG_ CU184832.20 Danio rerio protein_coding KNOWN, 2461 bp
GGCGGATCTGAGGGCTGCTGTCAATAACGGCGTCCGTAAC
CACTGTAAATAAAACACAAATACTGTCATTTACACTGATT
TCACTTCGCTTACCACGAGATCAATATTGAGGCTTCGGCT
TCAGCAGCTTTGGAGCGCCAGTCATGGCGTCTCTGTCCGA
GGAGGTGTTGTTGGTGGTGAAGAGGGTACGTCAGAGGAAA
CAGGACGGGACACTGTACCTTATGGCTGAGAGGATCGCCT
GGGGACCTGAGGGAAAAGACCGCTTCACTGTCAGCCACCT
CTACGCCGACATCCGCTGCCAGAAGATCAGTCCTGACGGT
AAAGCCAAGATTCAGCTTCAGCTGGTTCTGCACACAGGAG
AAAACACCACTTTTCACTTCGCCAATGAGAGCACAGCGCT
GAAGGATAGAGAAGCCGCCAAAGAGCTTCTCCAGCAGCTC
CTGCCCAAGTTCAAGAAGAAGGCCAATAAAGAGCTGGAGG
AGAAGAACAGGATGTTGCAGGAAGACCCCGTCCTGTTCCA
GCTCTATAAGGACCTGGTGGTGAGTCAGGTGATCAGCGCT
GAGGAGTTCTGGGCCAATCGGATGAGCCTCAATTCAGTGG
ATCACTCGCCCTCCAGTAATAACGTACAGGAAGTGGGCAT
CTCTGCTGCCTTCCTGGCCGACATCAGACCACAGACAGAC
GGCTGTAATGGCCTGCGGTACAATCTGACCTCTGACATCA
TCGAGTCGATCTTCAGGACTTACCCTACAGTCAAGCAGAA
ATACGCAGAGAACGTTCCTCACAACATGACGGAGAAGGAG
TTCTGGACACGTTTCTTTCAGTCTCATTATTTCCACAGAG
ATCGCATCAACACGGGCCAGCAGGACATCTTCTCTGAGTG
TGCCAAACAGGACGAGAAGGGCCTGAAGTCTATGGTGACC
CAGGGAGTGAAGAACCCAATGGTGGATCTGCTTGCACTCG
AAGATAAAACGTTAGATGAGGGTTACGGCACAGCGGCGGC
TCCCCCTGCGTCAAACACAGCCAACAAAACACTCAGAGAA
AACAGCAACTCCGCCATCATCAAGCGCTTCAACCACCACA
GTGCCATGGTCCTGGCAGCCGGCCTGCGGAAAGCGGAAGC
CCCCAGTGATCAAGCCAGCGAGACGAGCAGCACGGATGGA
AACTCCAGAGATTCAGATTTCTTTCAGCCGCCACTTAAAA
AGGTGAAATTACAGGAAGCCATAGAGTATGATGACCTGCA
AAACGACTCGGGCCGAAAGACCATCGCTCTGAACCTGAAG
AAATCAGACAGATATGCCCACGGGCCGGTCCCTCTTCAGT
CGCAGCATTACAGCACCAGTCAGGACATCATCAACTCCAT
CAGCATTATCCAGCACGAGATGAGGAGCTACAAACCCCAA
CTCACGCAGGTGATGTCCAGCAGTGCGGCGAGCTCAGCCA
TCAGCGCTCTTTCACCTGGAGGAGTTTTAATGCAGAGCGC
AGGCCAGCAGACCATCCACCAGTTAGTGCCCGCTGATGTT
CAGAGCGAGCTGAAGCACTTATACACGGCCGCCGGAGAGC
TGCTCCGACACTTCTGGTCCTGTTTCCCCGTCAACACTCC
CTTTCTGGAGGAGAAGGTGTTGAAAATGAAATCCAACCTG
GAGAGGTTTCAGGTGACCAAGCTCCGCCCCTTTCAAGAGA
AGATCCAGCGACAGTATTTGAGCACTAATCTTACAGGCCA
CCTGGAGGAGATGTTTCAGGCTGCATACAGCAAATTTCAA
GCCTGGCAGACACGCCGAATGATGAGGAAAACCTGAAGAG
ACTGAGAATAGAGAAATTGCCTAAAATGGAGAGAGGACTC
TGGGTAAATTTAAAGGAAACTAGAGAGGAACAAAAGCGCT
CACCCAGCTCGGGCTAACCGAAGCCGGACTGGTGGATTTT
CCAGCCAATCAGAGCTGGAGGTGCTAATGAGCACATCTGC
CATGGGGGAGGGGCTCAGAGAGAGCAAATACTGTCATCCT
ATTGGTCCACGTGGAAGTGGGCGGAGCCAGTCACCAATAA
CTGTAATTATTTTCTTCACTCTTTGTTCGTTCCGTTGACT
TCTTCAGTGCATAATTTAGCATTTTTTTTAACAGCCTTGT
GTTCTTATGACGACCAAACCGGGCTTTAATAATACCGGTG
GAAAGATTTCTCAGGAACTTCTAACGTTTAACGCAAAAGG
AGCTTTTAAGTGGATGACAAATCGGATATTAAACCCTCCC
GAAATCTTGAGATGCTGCTCAAGACACGCCAAGGGGAGAG
AGTATAGCAATACTGTAAAATAACAATAATAATCATCATA
ATCATAATAGTTTGTATGTAGTGCATTGACTGATTGGTGT
GCACCAACACACACTCGTGCGCACTGCTTTCTACCGTGTG
TCCTCTATAGCTGCACTGAGATGTGGATGTTCTTTCAAAT
AAAGTCACCATTTAAACTGTT

gtf2h1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gtf2h1-201 2461
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gtf2h1-201 Contained in:
[BAC] CH211-112D9 (1)

Genome Resources: Vega_Trans:OTTDART00000062068 (1),  Ensembl_Trans:ENSDART00000032390 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC081602 (1) 2493 nt
GenBank:EH997040 (1) 924 nt
GenBank:EE322117 (1) 874 nt
CITATIONS (2)