ZFIN ID: ZDB-TSCRIPT-141209-1111
Transcript Name: mfsd8-201
Previous Name: ottdart00000061915

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061915 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061915|OTTDARG00000042844|ZDB-GENE-060818-29 mfsd8|OTTDARP00000048422 mfsd8-001 LG_ CR848021.10 Danio rerio protein_coding KNOWN, 2907 bp
CAACACCAATGGACTTTAGACGGCGCCGTTCGGAATAACG
CTAAATTACTCCAACACTGCTCTGCTCCAAAACGCTACAA
TGGGAATATTATACATCGATCTGCAGGAGTTTTCGACATA
CGTACTGTGCAGCTCCAGACAGTTTTCAGTCATGTTGAAG
TAATTATAAACAACAAGAACTGCGCTTCAATGAGCTCGAC
GTTTCATTTCCAGAAGCTGCTTAGTCACTAATAATAATGC
CACTTGAGGAGTCCGGTGAAAACACTCCGCTTCTCAGAGG
CGAGATTATAAGTGATGGAGATACTGACAGAAGCAGATGG
AGGTCCATCAGGGTCATGTACTTTACCATGTTCCTTAGCA
GTGTTGGTTTTACGATTGTCATCACTTCAATTTGGCCCTA
TCTGAAGAAAATCGATGAAAGTGCAGATGCCAGTTTTTTG
GGATGGGTGGTTGCTGCATACAGTTTGGGTCAGATGGTGG
CCTCACCCTTCTTTGGATTGTGGTCCAATCACAGGCCTCG
ACGGGAGCCTCTAGTCTGCTCTATATTCATTAATGTCTCA
GCCAACATTTACTACTCCTATGTCTACCTACCTCCCTCAC
ACAACCAGATTCACATGCTCTTGGCTCGCACATTTGTGGG
TATCGGAGCAGGTAATGTAGCAGTGGTGAGGTCCTATGTG
GCTGGTGCCACTTCCCTGAAGGAAAGAACCAGTGCAATGG
CAAACATGAGTGCCTGTCAAGCTCTCGGCTTTATACTTGG
CCCAGCTCTGCAGGCTGTTTTGTCATTCATTGGAGAAACC
GGCGTGAGTGTGGATGTCATCAAGCTTCAGGTTAACATGT
ACACAGCTCCAGCGCTGTTGGCGGCCTGCTTTGGGGTCAT
TAACATTCTGCTGGTTATTTTAGTCTTGAGGGAGCACTCT
GTGGATGACCATGGGAACAGGATCCGTCCAATTAACTACA
CTCCAGAAGAGCGAGTAGATGTGCCTCCTGAGGTTGAAGG
TGATATCGACCATATTGCAGTGTTCACATCTAACGTCCTT
TTCTTCATCATTCTCTTTATTTTTGCTGTGTTTGAGACTA
TATCTACTCCTCTGTCAATGGACATGTTCGCATGGACAAG
AAAGGAAGCTGTTTTGTATAATGGCATCATATTGGCTGCC
ATAGGCTTTGAGTCCATCCTTGTCTTTCTGGTGGTAAAAG
TGGTTTCAGCACGGGTAGGAGATCGGCCACTGCTGCTTGG
AGGCTTGATTCTCATATTTGTAGGGTTTTTTATGCTGTTG
CCATGGGGAAATCAATATCCTAAAATACAGTGGACAGACA
TTAACAATAACACTATACCACCAATACAACTGGCACCCAC
CCCAGCCTCAAACAGTTCCCTGGAGCCCATTGGATGCCCG
TCCGAACAGACCTGGTGCTTGTTCACCCCTGTAATTCATC
TCGCACAGTACATCACCTCTGACATCCTGATCGGAGTGGG
CTATCCCACATGCAACGTCATGTCCTACACTTTATACTCA
AAGATACTGGGGCCCAAACCACAGGGAGTTTACATGGGAT
GGCTGACTGCATCAGGAAGTGGCGCGCGGACCCTCGGGCC
TGTCTTTGTTTCACACTTCTACACCATCCTGGGACCTCGC
TGGGCCTTCAGTGCCATATGTGGCATAGTGCTAGCTGCGA
TTGTAATGCTCAGCGCCATGTACAAGCGTCTCGTCGCCTT
CTCCATACGCCATGGACGGATAGCGGAATGATGGCATGAC
TGACAGGTGCCCCTACCGACTTCTTGAAGAGACAGTTCAT
ATGTATTACCCCTCAAGTGGTAACAAATCTTTTGTGTTTT
CTGTTGGAAACAAAAAGAAGATTATTTGAAGAATGTTGTA
ATCTGGTAGCCATTGAATTTTATAGTAGGAACAAGAAGAC
TTTGGAAGTCCATAGGAAGCAGTTTCAGACATTCTTGACA
ATATCTTCTGTCTTGTTCAACAGAAGTTCAGCATATTATG
ACATAATTGTCATTTTTTTTGGTCAACTATCCCTTTATAG
ACATGAACTTTCCCTTTAAGTGGGTCTGACTTAAACCTGT
GAATGCTATTTAATACACGTTCATGCTAATCATGATTTCT
TTAAAGTGATGATTCACCCAAAGCTAAGAATTCTGTCAGA
ATTTACTCCTTTACTCCCTTTTTTAATTTTAAAAGACAAA
TTTGAAGAAAGCTGGAAACCTGTAACCATTGACTTCCATA
GTATTTATTTTTCCTACTATGGAACTCAATCTTTACAGCT
TTCTTTTAAATCTCATAATCTTTTGTGTTGAACGGAATGA
AGAAATCTCTAAAGATACCATTTAAGAGAGAGTAAATAGT
GACTAAATGTTCATTTTTTGGGGGTGAACTATCCTTTTAA
GTAGACTGTCTTCCATTTAAATGTGAATAACATTCTTTAG
ACTACTATTAACTGAGCTGTGAATTGATCTACTATTGGAG
CAGAATGGCATGAATCATGTCACCGTTTAAAACGCACACA
GTTGCACAATCTAAACAGAGCGACGTGAATAAACCACAGT
ATTGACTATGTTTGGCAGCTCCATGAGTTAATGAAGTATC
GCAGGCTTATGCGGTTGTTTAAGCAAACACTTTACAGATT
CTGATTGTTTTGTTTTTAATAATTGTTGCTAATAAACTGA
ATTCCTGTTACTGTTAAACATTAACACACATTCAAATTTC
TAAGCTGATTGAAGTCGATGTTGAAGTTTGTTTTTAATAA
CACTAAGCTTAATGTACACTATGTTCTGAGCATTACTTGA
CTTTGGGTGCATCCTGAAGATTTAATATGATCACTGGTGA
TTGATGGGTGTTAAAGCACAGTATGGACTTTTCCTGAAAA
CCTTTAATAAACTAATGTTTTTAAAGA

mfsd8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mfsd8-201 2907
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mfsd8-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000061915 (1),  Ensembl_Trans:ENSDART00000168935 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC121197 (1) 2890 nt
GenBank:CK713109 (1) 352 nt
CITATIONS (2)