ZFIN ID: ZDB-TSCRIPT-131113-907
Transcript Name: cln6b-201
Previous Names: cln6b-001, ch211-139f22.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056249 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056249|OTTDARG00000039184|ZDB-GENE-110623-6 cln6b|OTTDARP00000044113 CH211-139F22.3-001 LG_ CU183952.17 Danio rerio protein_coding PUTATIVE, 1323 bp
AGACAGGCTTGATTTATTCATTTGCTCATTTCCTAAATCT
CTCCATCTCAGTGAACCCGAAGAGAGTAGCGTTTTGTACT
GTGTTTCAGACCCAAACATCAGGATTCAGGATGTTTTTAT
CCTTGTGTTTTACTCACTGATGTGGAAAACGACCATCTGA
GGCCGCCGAGATGCCGACTGTCATCCGCAAAAGGCAAAAC
TGTGGCCTGAGCACCACATTTTTGAGCAGATGTGGATTGA
GGGAGTTGAGAGAGTCCTGTCTGACCCCAGATCAGTTTCA
CAGCTGTTTCTGGTGCTGCTTTACTCTACAGAACTGGCTG
CTAGACATCGGCAGACCTGTAATAACGATCTTCTGTCCAC
TGGATTGGTTTCCTCTGAACAAACCCAGCGCTGCGGATTA
TTGCCACATGTTGTACAACATCACAACACCTTTCCTGCTG
CTCAAGCTGATGGAGCGCAGCCCGAAGACACTGCCGCGCT
CCGCCATGTACCTGTGCATCATCACCTTCGTCATGGGCTC
CAGCATTCACCTGCTCGGGGAATCCATAAACCAGCGGCTG
CTGATCAGCGGATACCAGACACACCTGACACTCAGAGAAA
ACCCCATTATTAAGAGCATCTCACCACACACACTGATCGA
CTCATTTGAGTTACTGCAGTATTATGATGAAAGTCTGGGC
CTCTGTATGTGGTACGTTCCTCTGTTTCTCATCCTGTTCC
TGTATTTCACTGGATGTTTCACTATCGTCAAAGCAGAGAA
GAAGATGCCCGTCTCCGCTTGGATTCTACTGGGTCCCAGT
GGCCTTTACTACTGGTATCTGGTGACAGAAGGACAGATTT
TCATCCCATTTATTTTCACGTTTTTCGCCATGATGGCTAC
AGTCCTGCATCAGAAGCGTAAAGGTTTTCTTCCTGACAGT
AATGGACTGTTTCTGCTCTACAGTTTCTCGATTTCGCTCT
TTTTAGTGAGCGTCTGGGTCGCCTGTCTGTGGAACGATAA
AGTGTTGCGGAAGAAATATCCAGGAGTGATGTATATCCCA
GAACCGTGGGCTCTTTACACATTACACCTCAGAGACAAAC
ACACCACGCTTACAGACTGAAAATATCACTTACAACACAA
AACATAAACTGCTTCCATCATTTCACAGTTGTTTATTTGT
TTTCAGAGTCCATTTCACGTCTCATTCCTGAAGTATTTTT
ACTCTATTCGAAGTAGTCAAGATTGATTTTCTTCAGTATT
ACTCATAAAAAAAAACAAGATTCCAGTTTTGTTGCTTTCT
AATTCCTTCATCATTCACCTTCATATTTCATTTCTTATGG
TCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cln6b-201 Contained in:
OTHER cln6b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056249 (1)
  • Ensembl_Trans:ENSDART00000127656 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL921052 (1) 539bp
    CITATIONS (2)