Transcript

zgc:92481-202

ID
ZDB-TSCRIPT-131113-902
Name
zgc:92481-202
Previous Names
  • ch1073-285g6.2-002
  • zgc:92481-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056233 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056233|OTTDARG00000039172|ZDB-GENE-040912-181 zgc:92481|OTTDARP00000044100 CH1073-285G6.2-002 LG_ CU855936.5 Danio rerio protein_coding NOVEL, 1165 bp
CTGCTCCGATGGCTCGCTGTTTATCAGGGGCTCCTCCTAT
GATGGCGTATGACTGCGCACGCTCTGCTCGTGTTCCTCTG
CGTGCAGGAGGAGGAGGAGACGCCATGATGTACCGTGAAG
CAAAGTCTGCACGGGTCTCTCAGCCGTCTGCCCCCGTCGT
CCTGATGGAGTGTGATTCTGCATCCGCTCAAGAACCTGAT
CACCAGCAGGACCCACTACTCCAGCTGGTGTCCCTGCAGA
GCGCCTCGGGCAGCTGGGAGATCAGCAGCGCTCTGTCTGC
GGTCCTGGAGAAACCCGAGGAGGAGCTCCGGAAACACACT
CCGGCACAGGCTGACGGGCCGCTCTGGGCCACTGTCCTCT
CCCTGCTGTGGTTGTTCTCCTGTAAGCTGCAGGATCGAGT
CGAGTGGCAGTTTGTGGCCCTGAAGGCGGCGGCGTGGGTG
CGCGCGCAGAACCAGGCCGGTGTGGCTGAGTGTGTGCGCA
GTGGGAATCTCCTCCTGGATTGTCAGCTGACTGCAGAAAC
TCTGGGCATCTGAGCTGCGGTTCAGGACAGAGGGAGTGTG
TGTGGGTGTGTGTGTGTGTGTGTGAGACAGAGTGTGCTCA
AAGAAGCCAGCAGGTGTCATTGCTGCTCCTGAATCCAGCT
GCTCTTCTCCAGATGCTGATGGCGGGTGTATTGAGCTGTG
GGTCAGGTGTTGGAGTGTGTTCTTGTGTTCATCATTCCGC
TGTGTCCTGATCTGCAGTGATGGTGGTTCAGTATCTCTGT
CTCTTCATTAGTCTGTCACAGGGTTGGGTTCGTTTGGGTT
TTTTCGATACTTTTTAAACGGTACTGGTGCCAAAATGGTA
CCTGAACCGATACTTTTGAGCCACAAATGATGGTGGACGA
CTCTAGAAAAATCTTTTATTTGACTAAATCTTTATAAAAA
TAGTTTGAATAGAACAATATTACTAAAGTTTGGTGTAAAC
ATCAGTTCATATTTCATGTTTGTGAATTACATTAATAAAT
CTCCTTTGATCATTCGCGGGCAGGGCAGGGCATCATGTAC
TTTTGTGTGCACATTTGACCATATATACATCACAAAATAC
TTACTCTAATTATTGGAAGTCATTAGTTTACATCACTCTG
CAGTCTTCATAAACAAGATAATTAAATAACTTGAACTCTA
AATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations