Transcript

zgc:92481-203

ID
ZDB-TSCRIPT-131113-4093
Name
zgc:92481-203
Previous Names
  • ch1073-285g6.2-001
  • zgc:92481-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056232 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056232|OTTDARG00000039172|ZDB-GENE-040912-181 zgc:92481|OTTDARP00000044099 CH1073-285G6.2-001 LG_ CU855936.5 Danio rerio protein_coding NOVEL, 1645 bp
CTTGGACTGAACTTCAGTTTCGGCGTCACTCCTCAAATCT
CATTCAAGCAGACACACACACATCTGGAGTTTCCTCAGGA
GCTGCTGTTATTCTCCTTTTCACACACAGAGTCGACCCCG
AGGACTGTCTGAGAGTATGGCGCTCTGCTGCGGGCTCGTG
TCCGAGAAGAATGTTCCTGTTCCTCTGAAGAGCATCAGCG
TGCAGCTGCAGGTCCGCGGTCACGTGTCCTCCGTGCGCGC
GACACTGCAGTACGTTAATGAGGAGGAGCGGCCACTGGAG
GCGCTGTTCGTGTTTCCACTTCCGGCTGAAGCCGCGCTCT
GCAGCTTTAGCGCGACTGTGGGAGGGCAGGAAATCCGGGG
GGAGCTGCGGGACAAGCAGACCGCGCGTGATGAGTATGAT
GACGGTGTGAGCGCGGGCCGGCAGGTGTTTCTGCTGGAGG
AGAGTGATCAGAGCGCAGACGTGTTCCGCCTCAGTGTGGG
CTGCCTACCTGCGGGCGGAGCGGCCACCGTCAGCTTCACC
TACAGCACTGAGCTCACTGTGGAGGAGGATGGAGGACTGC
GCTACTGCCTGCCGGCGGTGCTGAACCCGCGATACACACC
TGCAGCTGCAGGTGCAGGTGTTCCTCAGGTGTGTTCTGCG
TCTGTGATCCCCTACTCTCTCTCTCTCTCTGCGGATGTCA
GATCTTCAGTCCCCATCGCCAGACTGGATAGTAGCTGCGC
ACTGGAGCCGCTGCAGTTCCTGGACCCGCAACACACACAC
GCACAGGTGAGTCTGAGCGCAGGGCACCGCTTTGATAAGG
ATGTGGAGCTGCTGCTCTACTATGTGGATCCACATCAGCC
GTCTGCAGTGCTGGAGGCGGGAGCGGCCACGGCTCCTGCA
GGCTCGCTGATGGCCGACCCGCTGCTCATGCTCAGTCTCT
ACCCAGAGTTCCCGGCGGCAGTGATGTCATCACTGACCTC
TCACGGAGAGTTCATCTTCCTGGTGGACCAATCAGGCAGC
ATGGACTGCCCAATGCATCATGGGGAGGGGGCTCAGATGC
GCATCGAGAGCGCCAGGGACACACTCCTGCTGCTCCTCAA
GAGTCTCCCCCTCGGCTGCTACTTCAACATCTACGGCTTC
GGCTCCAGCTTCCAGGCCTTCTTTCCGCAGAGTGTGCTGT
ACAGTGAGCAGACGCTGCAGGAGGCGCTGCAGAGAGTGAA
GCTCATGCGTGCAGATCTGGGCGGCACCGAGATCCTGCAG
CCGCTGCAGCACATCTACAGGCAGGCCTGCATCCCGGAGC
ACCCGCGGCAGCTCTTCATCTTCACTGACGGAGAGGTCTG
GAACACCCGAGAGCTGCTGGATCTGGTCAGAGCGCACTCA
TCCTCCCACCGGTGTTTCTCCTTCGGGATCGGCGAGGGTG
CGAGTACCGCCCTCATCACTGGAATGGCTAAGGAGGGTTC
TGGGCACGCTCAGTTCATCACCGGCAGCGACCGCATGCAG
CCCAAAGTCATGCAGTCGCTGCGCTTCGCTCTGCAGCCGG
CGGTGGAGGAGCTGTGTGTGGACTGGAGGCTGCCGGAGGG
TGTATCGGTGGAGCTGCTGTCTCCGCCCGTCCGCTCGCTG
TTCCAGGGTCAGAGGGCGCTGCTGTACGGCCGGCTGAGGG
GGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations