Transcript

ppil1-202

ID
ZDB-TSCRIPT-131113-632
Name
ppil1-202
Previous Names
  • ppil1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055115 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055115|OTTDARG00000038466|ZDB-GENE-051009-1 ppil1|OTTDARP00000043226 ppil1-001 LG_ CU855953.4 Danio rerio protein_coding KNOWN, 812 bp
AGGAGATTGTGTTTCTCCTCATGCTCGAGACTCCATTACT
CTTGCCCTTGTGTCTTCATCAGGCATCTTCAGACTGGTTT
GAGAGGTATGGCCCTGCATGGAAGAAGCAACATTTAACAA
GTGGAAGGAGCAGGAAGTGATCTACATCTGCTGAAGCGAC
ACTGCGACACAATGGCATCTCTTGTCCATGACTTCACACT
GAACGACTGCAACTGGAACTGAAAGGATATGGCTGGAATA
CCGCCGGATTCATGGCAACCTCCTACTGTTTCGCTGGACA
CAACGATGGGAACTATTGTGCTTGAGCTGTACTGGAATCA
TGCGCCAAAAACATGCAAGAATTTCGCAGAGCTGGGCAGA
AGAGGATATTACAACAGCACAAAGTTTCATCGAATTATTA
AAGACTTCATGGTTCAAGGAGGCGATCCAACAGGCACAGG
TCGTGGTGGTGCATCAATATATGGCAAGCAGTTTGAGGAT
GAATTTCATCCAGAGTTGAAATTTACAGGTGCTGGAATTC
TGGCTATGGCCAATGCAGGGCCGGATACAAACGGAAGCCA
GTTCTTTCTCTCGTTGGCTCCCACACAATGGCTGGATGGG
AAACACACTATATTTGGACGGGTCTGCCAGGGCATTGGTG
TTCTTAATCGAATCGGCATGGTGGAAACCAACAGTCAGGA
CCGCCCTGTGGATGACATTAAAATCCTCAGAGTGAATCTG
CCCAGCTAAGACGTTTGTGCTTGCACAATGTTTTACGCTT
TATTTTTGTACAGCCATTTTATTACATTAAACGTTCGGAA
TTCTCAGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations