Transcript

ppil1-002

ID
ZDB-TSCRIPT-131113-2221
Name
ppil1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055116 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055116|OTTDARG00000038466|ZDB-GENE-051009-1 ppil1|no_translation ppil1-002 LG_ CU855953.4 Danio rerio protein_coding KNOWN, 688 bp
TCTTCGCTTCAGGAGCTTTAGGAGATTGTGTTTCTCCTCA
TGCTCGAGACTCCATTACTCTTGCCCTTGTGTCTTCATCA
GGCATCTTCAGACTGGTTTGAGAGGTATGGCCCTGCATGG
AAGAAGCAACATTTAACAAGTGGAAGGAGCAGGAAGTGAT
CTACATCTGCTGAAGCGACACTGCGACACAATGGCATCTC
TTGTCCATGACTTCACACTGAACGACTGCAACTGGAACTG
AAAGGATGACACCTGAGATCTGTGTGACAAACACTAATTG
AACTGCGCCTACACAGTTCGTCTTTCCTGTTCGCTGTGCT
GGAGGAGGAAGTAATGCCAGTCGGTAAAATATTAAAATGA
CTGGTAGACATGCGGCTCTCATGTTAGTGATTTGACACTT
ATATTACAGGTCTATGTGTTGTCTGATGGAATGTGCAAAG
AAAATTCACATTTTAAAAGAGATTTGATTTACTTCAAAAT
GAAAAGTCATTATTTGCTCACTTTCAACTTGATCTCAACC
CCATTTGAGTTTTTTTGCTTTTTTCCAATACATGTTTACG
GTCTCATTTTAGTGTAAACTAGCCATTTAAATGATAAAGA
AGAAACCGACTGTCAGCTCATTTGAACATTTTTGTTTTTT
ATGAATAAATATGTGCCACCAATAAAAATGTTTGTTTTTG
GAAGATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations