ZFIN ID: ZDB-TSCRIPT-131113-623
Transcript Name: ankrd33ab-202
Previous Names: ankrd33ab-002, dkey-195m11.10-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055087 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055087|OTTDARG00000038447|ZDB-GENE-100729-1 ankrd33ab|OTTDARP00000043204 DKEY-195M11.10-002 LG_ CR753817.13 Danio rerio protein_coding NOVEL, 887 bp
GAAACGTTTGTGTCCTTGAACAGTTATAGTTTCAATTGGT
ACCAGTGTATTTTTCTTAAATCTTCAATTGCTTGATCAGA
GTCTTGAGGTTTATTTCTGTTGGTCTGTTTACTTCTAAAC
AGGGGTCATAAACACTTGGAGTGCATTCCTTCACCTCGGG
TTTCTGACCTGCTGCAACCATGTTGAGACACTTTCCTCAG
ATGCCAGCAAAGATGCTGTAGACAAGATTGATCTGTTAAG
GGATGGCAGCAGTTCAGAGCTCTGGCTTTGAGGACCCCCA
CCTGGGGTCATGCCCAGATGGAGATGAAATCTCACTTTTG
GATGAAGACACAGACTCTGGAAGTTTGCTGTCTGAAGATT
CCGTGCTCCCTGAGTATGAACTAGAGGATGGGAAAAAGGG
AACTGCCAACACACTGTATGAGGCTTGTGTCCAGAATGAC
CCAGAAGCGCTGAAGAGGATTTTGGAACGTGGTGTGACCT
GTGATGAGGTCATGGAAGTTGACATTAATGGATGGAATGG
ACTGATGGTGGCTGCATATAAAGGCTTTCTTCAAATAGTG
TATGAGCTGCATGGGTGCCCACATTTGAACATTAACCACC
AAGACAATGACGGCAACACCGCCCTTATGATCGCCGCTCA
AGCTGGTCATGTCTCCATATGTAACTACATCATGAATTAC
TTCCCTGGAGCAGACACAGAGATCAGAGATAACAGAGGAT
TCACTGCCCTCATTAAAGCTGCCATACAGGGCAGGAATGA
TGTGGTGGCTGCTCTTATAATGCACGGTGCTGATGTAAAT
GCTGTAGACTCCAATCGTGGTAAATGTGCACGTGACTGGG
CGCTGAAGACGGGCCGCTTTGACACGCTGAAACGACTGCG
CCACCTT

ankrd33ab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ankrd33ab-201 (1) 2135
ankrd33ab-202 887
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankrd33ab-202 Contained in:
OTHER ankrd33ab-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055087 (1)
  • Ensembl_Trans:ENSDART00000155088 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH440618 (1) 895bp
    CITATIONS (2)