ZFIN ID: ZDB-TSCRIPT-131113-3807
Transcript Name: ankrd33ab-201
Previous Names: ankrd33ab-001, dkey-195m11.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055086 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055086|OTTDARG00000038447|ZDB-GENE-100729-1 ankrd33ab|OTTDARP00000043203 DKEY-195M11.10-001 LG_ CR753817.13 Danio rerio protein_coding NOVEL, 2135 bp
TCAAAGACCATTGTAAGAGTGAGTGTGTCTGTATGTGAAA
GGTGATTATGCAGCGAATGTCTACATTGGATCCTTTCTGA
TCCTGAAAGGCATTAGTCGGTCTAATGACCTGAGGTGTAC
TGACAGAGCATGCATACGCCCATCTATGATCACATACTAC
ACACACACTAGGTAGACGTGATGCTGATGGCTGTGTTTTC
TGGAAGCTGATCTGAATTTTCTGATAATAGCGCTGTAAAA
GTTGATACCAGGATACACTCTTCTTCTGAAATGTGGACAT
AGGGGTCATAAACACTTGGAGTGCATTCCTTCACCTCGGG
TTTCTGACCTGCTGCAACCATGTTGAGACACTTTCCTCAG
ATGCCAGCAAAGATGCTGTAGACAAGATTGATCTGTTAAG
GGATGGCAGCAGTTCAGAGCTCTGGCTTTGAGGACCCCCA
CCTGGGGTCATGCCCAGATGGAGATGAAATCTCACTTTTG
GATGAAGACACAGACTCTGGAAGTTTGCTGTCTGAAGATT
CCGTGCTCCCTGAGTATGAACTAGAGGATGGGAAAAAGGG
AACTGCCAACACACTGTATGAGGCTTGTGTCCAGAATGAC
CCAGAAGCGCTGAAGAGGATTTTGGAACGTGGTGTGACCT
GTGATGAGGTCATGGAAGTTGACATTAATGGATGGAATGG
ACTGATGGTGGCTGCATATAAAGGCTTTCTTCAAATAGTG
TATGAGCTGCATGGGTGCCCACATTTGAACATTAACCACC
AAGACAATGACGGCAACACCGCCCTTATGATCGCCGCTCA
AGCTGGTCATGTCTCCATATGTAACTACATCATGAATTAC
TTCCCTGGAGCAGACACAGAGATCAGAGATAACAGAGGAT
TCACTGCCCTCATTAAAGCTGCCATACAGGGCAGGAATGA
TGTGGTGGCTGCTCTTATAATGCACGGTGCTGATGTAAAT
GCTGTAGACTCCAATCGTGGTAAATGTGCACGTGACTGGG
CGCTGAAGACGGGCCGCTTTGACACGCTGAAACGACTGCG
CCACCTTGCGCTCCATCCCACAGCGGAGCAGTTCTGTGAT
ACCTACGTTCCCGAGTGGCCCAACCTCAAGGTGCTGGTCA
GCAAAGCAACAGCCAACAGGAGTGCAGGTCAGAAGTTGAC
ACATCATTTGAAGAATAGGTTCGGTTTCAGCTTCCCACGT
GACCCAGTGGAAAACGGTGTCATGGATCACATGGTGCGAA
TGACCACCAGTCTGCATAGCCCACTCATAGCTACAGCTAC
ACGACCACTGTGCCCGAGCAGCCCTCCACAGATGGGTAAA
CGGCGGCTGGCTGTGGCTGAGCTGATGCAAAAGCACTCTG
AGAAACTGCTGGAGGAGAGTTCACTGTGCCACCGAAACAG
CTCCATCTCCTCTGTGTCTCCATCTTTCCATTCAGCCGAG
TTTGTGTCTATGACCTGCTGTCCCGATACTGAGAGACGGG
GCAGTGTGCTGTCCATTGGTATGCGCACATTCATTCCTCG
TAGCGTAGCATCAAGGCGCAATAGCATTTTCCCCTCCGGC
TGCATCCCACAGATCAAAGTCACCAAATCCTCCGAGCCAA
CTCCGAAGAAAGAAAAGAAGAACAAAAAAGATAAGGGCTA
CCTGGAGCCTCCAAAGTGGAAGTATAAGGAGGCCAAGGAA
GAGAAGAAGAAAGAGAAAAAAGCCTTGAAGGAAAAGGAAA
AGGAGGAGAAGGACAAAGAGAAAAAAAGCAAAGACAAGGA
GAAAAGAAAAAAGAATAAATACACTGACTGAAAGTGATGC
ACTTTGGTTACAATGTCTTCCCTTTATTCATATCGAAGTC
CCTTTAAGGCAAGTCATTTCACTCAGTGGCCATCTTTGAA
ATGCCTACAGTTTATAGTTGGAATCAACATTAAAATTTAA
TAACAGACTCGTAAGATAATATAGATTTCTTGACCTCATT
ATTTCCTCATGGAGGTAAATATGTAAGATGAATTAGAATC
AGTCTAAATTTAATGATCACTTAAAATTGTATTTCATTTA
TAAAATGGAACCTTACAGTCTCTTAAGGACTTTCGGTTTA
TAAAAGTTTGAATCATACACACACACACACACACACACAC
ACACACACACACACA

ankrd33ab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ankrd33ab-201 2135
ankrd33ab-202 (1) 887
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankrd33ab-201 Contained in:
OTHER ankrd33ab-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055086 (1)
  • Ensembl_Trans:ENSDART00000023686 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB866306 (1) 544bp
    CITATIONS (2)