Transcript

catip-201

ID
ZDB-TSCRIPT-131113-496
Name
catip-201
Previous Names
  • catip-001
  • ch73-71c20.6-001
  • zgc:153063-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054306 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054306|OTTDARG00000037934|ZDB-GENE-060929-1170 catip|OTTDARP00000042660 CH73-71C20.6-001 LG_ CU639421.4 Danio rerio protein_coding KNOWN, 1377 bp
AGGAAACCAAAGATGCTAATAAGTTCGAGGCATGATCGAC
AAAACACACAAACGATAAATAAAGACGTTTATATGCCCTA
ATTTTGACGCTGATTTTTGTAACGCATTTTTGAAGCTGCA
GTTTCATGATATTCTGTTTTTATTAGCATTAGCGAAGCAA
AATAGCGTGTTGAAGCCTGTTGAAGGATAAGCTGTTAAAA
CCAGTACGATCCAGGAGTTTTTAAGACATGGAGGAAAGTG
AATTAACTCAGAATGAAACAGAAGAGCTAAAAGCTTCAGT
CAGTGCAGTGGAGTTTATTCACATTGCACAGAGGGATCTG
GAGCAGTGTTTGTTTGCAGACTCACTTGTGACCGTGTCTG
ATTCAGGCAGAGAACTGGGAGATTTCTCTGTAAGTGTTAC
TAAAGCGAGCTACAATGAGGAGCTTTGCTATCTGCTCCAT
GCCAATAGTCACGGAACTATCGATGACGTCCCTTGTGGCA
CATCCATCGTAGCCTATATATCCAGAAAGCTCGAGATACT
GGAAGAGAATCATCATGAATATGTAAAGCTGGAAAAGAAA
ACGGTGGACCGGAAGATTCATATTGTTAGACAAGATGATC
AACTAGTGGTTGACCGAGTCATCTCAGAGAGAGAGGGAGT
GAAAACACAAACCCTCAAATTCCCATTGAGCTCTCTAGAT
GGCTTTGTGTCTGAGGCATCCAACTTCCTCCTCCTGCGCA
TAATGGCTCGACAGAAGATTGTTCCGGAAAACATGACATT
CCTGTCATTAGATGCAGATTCTGGGCTTTCTAAGTCAGTT
TATAAAGCACTTGGGTGGCAGAAGCAGATGGTTGGGGAAG
ATTTAGTCGATATCTTTGGGATTGAAAGGACCATCTACTC
TGCAAATCTCTCCTCAGCAACCTGGCATTGCTTCTTCATG
CCTGATGGGCATCTTGCAAGCAGAGTGCAGTTGGGCTCAC
CTGCAGTGATGAAGTTACTGCATTTGCCTTTCTTACTGGA
TGGAGTGATTAAAACTTTTTTTTTTCTAGTGGAGAAGGAC
AAGATTCCTGTGATGGAGAAGAAGCCACTCATATGGGAGG
AAGATATGGAGCTTTATTCAAAGTTTCTTGACAGAAAGGA
AGAGCTCAAAGCAGATTACTCCTCATACCTCAGACAACAC
CCTGAGCTGAAGGCTTTACTGGCGGACTTCCTGCAGTTTC
TGCTGTTGAGAAAACCTCAAGATGTCTTCTCTTTTGCTCG
TGACTTTTTTGCACCTTTTGCCTCTCAAAGTCCTCCTGGA
AAATCCCAGGAGTTCTGAAACATTCGATTTTTAAATGCTA
ACCATGATTTGTCTGATGTTATCCAGGACAGAAAATAAAG
GTTTTCTTCTAATGGCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations