Transcript

catip-202

ID
ZDB-TSCRIPT-131113-2070
Name
catip-202
Previous Names
  • catip-002
  • ch73-71c20.6-002
  • zgc:153063-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054307 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054307|OTTDARG00000037934|ZDB-GENE-060929-1170 catip|OTTDARP00000042661 CH73-71C20.6-002 LG_ CU639421.4 Danio rerio protein_coding KNOWN, 652 bp
CAAAACACACAAACGATAAATAAAGACGTTTATATGCCCT
AATTTTGACGCTGATTTTTGTAACGCATTTTTGAAGCTGC
AGTTTCATGATATTCTGTTTTTATTAGCATTAGCGAAGCA
AAATAGCGTGTTGAAGCCTGTTGAAGGATAAGCTGTTAAA
ACCAGTACGATCCAGGAGTTTTTAAGACATGGAGGAAAGT
GAATTAACTCAGAATGAAACAGAAGAGCTAAAAGCTTCAG
TCAGTGCAGTGGAGTTTATTCACATTGGCATCTTGCAAGC
AGAGTGCAGTTGGGCTCACCTGCAGTGATGAAGTTACTGC
ATTTGCCTTTCTTACTGGATGGAGTGGAGAAGGACAAGAT
TCCTGTGATGGAGAAGAAGCCACTCATATGGGAGGAAGAT
ATGGAGCTTTATTCAAAGTTTCTTGACAGAAAGGAAGAGC
TCAAAGCAGATTACTCCTCATACCTCAGACAACACCCTGA
GCTGAAGGCTTTACTGGCGGACTTCCTGCAGTTTCTGCTG
TTGAGAAAACCTCAAGATGTCTTCTCTTTTGCTCGTGACT
TTTTTGCACCTTTTGCCTCTCAAAGTCCTCCTGGAAAATC
CCAGGAGTTCTGAAACATTCGATTTTTAAATGCTAACCAT
GATTTGTCTGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations