ZFIN ID: ZDB-TSCRIPT-131113-4789
Transcript Name: ltb4r-002
Previous Name: ch211-272h9.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060095 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060095|OTTDARG00000023476|ZDB-GENE-070705-164 ltb4r|no_translation CH211-272H9.1-002 LG_ CR847899.28 Danio rerio protein_coding KNOWN, 539 bp
CGTTTTCGGTTAGGGCGTGCGCACCTGTGTTGGAATGATG
GCTGATATCGAGAAAGACGTGCGAGTATACTGCGGCCACA
CCATATCGCCATCTGCTGTTCTGAGAATGACGGTCATGCT
GTCTGTGTAGTGATTGGTGTGATGCAGGGCTCCTCTTCTT
TTCTAAACGTGGCAAAAGTGGGTCGTCCCAATGTGACAGC
ATTCGCATTCATGAGCAGCAGTGTGAATCCAGTCCTGTAC
GTGTTCGCTGGCAGCTCTCACATCCGTCAGGCTGGTTTAG
GCTTCATGGCGAAACTTTTCGAAGGGACCAATTCAGAGAT
GGGCTCCAGCCGCAGCACCAGGTCCAGCCGCGGCTCAAAT
ACAGAAAACTCCGTCTTCACAAAACTGTCTGTCAAGCTGA
ATCGCAAAGGTGATGGTGCAGGAGCCGAGACCCATGATGG
AGAAGAGGGGACCTTGGCGGACAAGACTCTGACCCCCCTG
CACTGAAGTGTTCGTTTATTCCCTCGAGGCTCATTTATAG
TGTTAGTGAAGCTGCTGGA

ltb4r TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ltb4r-202 (1)    Ensembl 3752
ncRNA ltb4r-002 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ltb4r-002 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000060095 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL924346 (1) 539 nt
GenBank:CR926779 (1) 539 nt
CITATIONS (1)